ID: 1146090690

View in Genome Browser
Species Human (GRCh38)
Location 17:29874400-29874422
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37060
Summary {0: 188, 1: 7916, 2: 11056, 3: 10152, 4: 7748}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146090690_1146090698 13 Left 1146090690 17:29874400-29874422 CCCACCCAGATCTCATCTTGAAT 0: 188
1: 7916
2: 11056
3: 10152
4: 7748
Right 1146090698 17:29874436-29874458 ACCCCGATAAGGGAGAGACCAGG 0: 1
1: 0
2: 0
3: 3
4: 56
1146090690_1146090695 3 Left 1146090690 17:29874400-29874422 CCCACCCAGATCTCATCTTGAAT 0: 188
1: 7916
2: 11056
3: 10152
4: 7748
Right 1146090695 17:29874426-29874448 ACTCCCTATAACCCCGATAAGGG 0: 1
1: 0
2: 0
3: 1
4: 35
1146090690_1146090694 2 Left 1146090690 17:29874400-29874422 CCCACCCAGATCTCATCTTGAAT 0: 188
1: 7916
2: 11056
3: 10152
4: 7748
Right 1146090694 17:29874425-29874447 TACTCCCTATAACCCCGATAAGG 0: 1
1: 0
2: 0
3: 3
4: 43
1146090690_1146090702 16 Left 1146090690 17:29874400-29874422 CCCACCCAGATCTCATCTTGAAT 0: 188
1: 7916
2: 11056
3: 10152
4: 7748
Right 1146090702 17:29874439-29874461 CCGATAAGGGAGAGACCAGGTGG 0: 1
1: 0
2: 1
3: 56
4: 596

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146090690 Original CRISPR ATTCAAGATGAGATCTGGGT GGG (reversed) Intronic