ID: 1146090691

View in Genome Browser
Species Human (GRCh38)
Location 17:29874401-29874423
Sequence AATTCAAGATGAGATCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37619
Summary {0: 204, 1: 7933, 2: 11320, 3: 9617, 4: 8545}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146090691_1146090694 1 Left 1146090691 17:29874401-29874423 CCACCCAGATCTCATCTTGAATT 0: 204
1: 7933
2: 11320
3: 9617
4: 8545
Right 1146090694 17:29874425-29874447 TACTCCCTATAACCCCGATAAGG 0: 1
1: 0
2: 0
3: 3
4: 43
1146090691_1146090695 2 Left 1146090691 17:29874401-29874423 CCACCCAGATCTCATCTTGAATT 0: 204
1: 7933
2: 11320
3: 9617
4: 8545
Right 1146090695 17:29874426-29874448 ACTCCCTATAACCCCGATAAGGG 0: 1
1: 0
2: 0
3: 1
4: 35
1146090691_1146090702 15 Left 1146090691 17:29874401-29874423 CCACCCAGATCTCATCTTGAATT 0: 204
1: 7933
2: 11320
3: 9617
4: 8545
Right 1146090702 17:29874439-29874461 CCGATAAGGGAGAGACCAGGTGG 0: 1
1: 0
2: 1
3: 56
4: 596
1146090691_1146090698 12 Left 1146090691 17:29874401-29874423 CCACCCAGATCTCATCTTGAATT 0: 204
1: 7933
2: 11320
3: 9617
4: 8545
Right 1146090698 17:29874436-29874458 ACCCCGATAAGGGAGAGACCAGG 0: 1
1: 0
2: 0
3: 3
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146090691 Original CRISPR AATTCAAGATGAGATCTGGG TGG (reversed) Intronic