ID: 1146090692

View in Genome Browser
Species Human (GRCh38)
Location 17:29874404-29874426
Sequence TACAATTCAAGATGAGATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35196
Summary {0: 163, 1: 7168, 2: 10574, 3: 9468, 4: 7823}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146090692_1146090702 12 Left 1146090692 17:29874404-29874426 CCCAGATCTCATCTTGAATTGTA 0: 163
1: 7168
2: 10574
3: 9468
4: 7823
Right 1146090702 17:29874439-29874461 CCGATAAGGGAGAGACCAGGTGG 0: 1
1: 0
2: 1
3: 56
4: 596
1146090692_1146090694 -2 Left 1146090692 17:29874404-29874426 CCCAGATCTCATCTTGAATTGTA 0: 163
1: 7168
2: 10574
3: 9468
4: 7823
Right 1146090694 17:29874425-29874447 TACTCCCTATAACCCCGATAAGG 0: 1
1: 0
2: 0
3: 3
4: 43
1146090692_1146090704 29 Left 1146090692 17:29874404-29874426 CCCAGATCTCATCTTGAATTGTA 0: 163
1: 7168
2: 10574
3: 9468
4: 7823
Right 1146090704 17:29874456-29874478 AGGTGGACTTAATTGAATCATGG 0: 2
1: 40
2: 1227
3: 2387
4: 4672
1146090692_1146090695 -1 Left 1146090692 17:29874404-29874426 CCCAGATCTCATCTTGAATTGTA 0: 163
1: 7168
2: 10574
3: 9468
4: 7823
Right 1146090695 17:29874426-29874448 ACTCCCTATAACCCCGATAAGGG 0: 1
1: 0
2: 0
3: 1
4: 35
1146090692_1146090698 9 Left 1146090692 17:29874404-29874426 CCCAGATCTCATCTTGAATTGTA 0: 163
1: 7168
2: 10574
3: 9468
4: 7823
Right 1146090698 17:29874436-29874458 ACCCCGATAAGGGAGAGACCAGG 0: 1
1: 0
2: 0
3: 3
4: 56
1146090692_1146090705 30 Left 1146090692 17:29874404-29874426 CCCAGATCTCATCTTGAATTGTA 0: 163
1: 7168
2: 10574
3: 9468
4: 7823
Right 1146090705 17:29874457-29874479 GGTGGACTTAATTGAATCATGGG 0: 2
1: 42
2: 1113
3: 2485
4: 7295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146090692 Original CRISPR TACAATTCAAGATGAGATCT GGG (reversed) Intronic