ID: 1146090693

View in Genome Browser
Species Human (GRCh38)
Location 17:29874405-29874427
Sequence GTACAATTCAAGATGAGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29063
Summary {0: 19, 1: 726, 2: 7317, 3: 10689, 4: 10312}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146090693_1146090698 8 Left 1146090693 17:29874405-29874427 CCAGATCTCATCTTGAATTGTAC 0: 19
1: 726
2: 7317
3: 10689
4: 10312
Right 1146090698 17:29874436-29874458 ACCCCGATAAGGGAGAGACCAGG 0: 1
1: 0
2: 0
3: 3
4: 56
1146090693_1146090694 -3 Left 1146090693 17:29874405-29874427 CCAGATCTCATCTTGAATTGTAC 0: 19
1: 726
2: 7317
3: 10689
4: 10312
Right 1146090694 17:29874425-29874447 TACTCCCTATAACCCCGATAAGG 0: 1
1: 0
2: 0
3: 3
4: 43
1146090693_1146090706 30 Left 1146090693 17:29874405-29874427 CCAGATCTCATCTTGAATTGTAC 0: 19
1: 726
2: 7317
3: 10689
4: 10312
Right 1146090706 17:29874458-29874480 GTGGACTTAATTGAATCATGGGG 0: 2
1: 37
2: 1092
3: 2502
4: 7266
1146090693_1146090695 -2 Left 1146090693 17:29874405-29874427 CCAGATCTCATCTTGAATTGTAC 0: 19
1: 726
2: 7317
3: 10689
4: 10312
Right 1146090695 17:29874426-29874448 ACTCCCTATAACCCCGATAAGGG 0: 1
1: 0
2: 0
3: 1
4: 35
1146090693_1146090705 29 Left 1146090693 17:29874405-29874427 CCAGATCTCATCTTGAATTGTAC 0: 19
1: 726
2: 7317
3: 10689
4: 10312
Right 1146090705 17:29874457-29874479 GGTGGACTTAATTGAATCATGGG 0: 2
1: 42
2: 1113
3: 2485
4: 7295
1146090693_1146090702 11 Left 1146090693 17:29874405-29874427 CCAGATCTCATCTTGAATTGTAC 0: 19
1: 726
2: 7317
3: 10689
4: 10312
Right 1146090702 17:29874439-29874461 CCGATAAGGGAGAGACCAGGTGG 0: 1
1: 0
2: 1
3: 56
4: 596
1146090693_1146090704 28 Left 1146090693 17:29874405-29874427 CCAGATCTCATCTTGAATTGTAC 0: 19
1: 726
2: 7317
3: 10689
4: 10312
Right 1146090704 17:29874456-29874478 AGGTGGACTTAATTGAATCATGG 0: 2
1: 40
2: 1227
3: 2387
4: 4672

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146090693 Original CRISPR GTACAATTCAAGATGAGATC TGG (reversed) Intronic