ID: 1146090695

View in Genome Browser
Species Human (GRCh38)
Location 17:29874426-29874448
Sequence ACTCCCTATAACCCCGATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 35}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146090689_1146090695 4 Left 1146090689 17:29874399-29874421 CCCCACCCAGATCTCATCTTGAA 0: 184
1: 7905
2: 11315
3: 9458
4: 7160
Right 1146090695 17:29874426-29874448 ACTCCCTATAACCCCGATAAGGG 0: 1
1: 0
2: 0
3: 1
4: 35
1146090690_1146090695 3 Left 1146090690 17:29874400-29874422 CCCACCCAGATCTCATCTTGAAT 0: 188
1: 7916
2: 11056
3: 10152
4: 7748
Right 1146090695 17:29874426-29874448 ACTCCCTATAACCCCGATAAGGG 0: 1
1: 0
2: 0
3: 1
4: 35
1146090693_1146090695 -2 Left 1146090693 17:29874405-29874427 CCAGATCTCATCTTGAATTGTAC 0: 19
1: 726
2: 7317
3: 10689
4: 10312
Right 1146090695 17:29874426-29874448 ACTCCCTATAACCCCGATAAGGG 0: 1
1: 0
2: 0
3: 1
4: 35
1146090692_1146090695 -1 Left 1146090692 17:29874404-29874426 CCCAGATCTCATCTTGAATTGTA 0: 163
1: 7168
2: 10574
3: 9468
4: 7823
Right 1146090695 17:29874426-29874448 ACTCCCTATAACCCCGATAAGGG 0: 1
1: 0
2: 0
3: 1
4: 35
1146090691_1146090695 2 Left 1146090691 17:29874401-29874423 CCACCCAGATCTCATCTTGAATT 0: 204
1: 7933
2: 11320
3: 9617
4: 8545
Right 1146090695 17:29874426-29874448 ACTCCCTATAACCCCGATAAGGG 0: 1
1: 0
2: 0
3: 1
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146090695 Original CRISPR ACTCCCTATAACCCCGATAA GGG Intronic