ID: 1146090695 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:29874426-29874448 |
Sequence | ACTCCCTATAACCCCGATAA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 37 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 1, 4: 35} |
Found 5 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1146090692_1146090695 | -1 | Left | 1146090692 | 17:29874404-29874426 | CCCAGATCTCATCTTGAATTGTA | 0: 163 1: 7168 2: 10574 3: 9468 4: 7823 |
||
Right | 1146090695 | 17:29874426-29874448 | ACTCCCTATAACCCCGATAAGGG | 0: 1 1: 0 2: 0 3: 1 4: 35 |
||||
1146090691_1146090695 | 2 | Left | 1146090691 | 17:29874401-29874423 | CCACCCAGATCTCATCTTGAATT | 0: 204 1: 7933 2: 11320 3: 9617 4: 8545 |
||
Right | 1146090695 | 17:29874426-29874448 | ACTCCCTATAACCCCGATAAGGG | 0: 1 1: 0 2: 0 3: 1 4: 35 |
||||
1146090690_1146090695 | 3 | Left | 1146090690 | 17:29874400-29874422 | CCCACCCAGATCTCATCTTGAAT | 0: 188 1: 7916 2: 11056 3: 10152 4: 7748 |
||
Right | 1146090695 | 17:29874426-29874448 | ACTCCCTATAACCCCGATAAGGG | 0: 1 1: 0 2: 0 3: 1 4: 35 |
||||
1146090689_1146090695 | 4 | Left | 1146090689 | 17:29874399-29874421 | CCCCACCCAGATCTCATCTTGAA | 0: 184 1: 7905 2: 11315 3: 9458 4: 7160 |
||
Right | 1146090695 | 17:29874426-29874448 | ACTCCCTATAACCCCGATAAGGG | 0: 1 1: 0 2: 0 3: 1 4: 35 |
||||
1146090693_1146090695 | -2 | Left | 1146090693 | 17:29874405-29874427 | CCAGATCTCATCTTGAATTGTAC | 0: 19 1: 726 2: 7317 3: 10689 4: 10312 |
||
Right | 1146090695 | 17:29874426-29874448 | ACTCCCTATAACCCCGATAAGGG | 0: 1 1: 0 2: 0 3: 1 4: 35 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1146090695 | Original CRISPR | ACTCCCTATAACCCCGATAA GGG | Intronic | ||