ID: 1146091893

View in Genome Browser
Species Human (GRCh38)
Location 17:29887557-29887579
Sequence CCTCATCTGTAAAATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2476
Summary {0: 3, 1: 53, 2: 225, 3: 664, 4: 1531}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146091888_1146091893 -2 Left 1146091888 17:29887536-29887558 CCCTTATCTGTGCCTCTATTTCC 0: 1
1: 0
2: 9
3: 97
4: 776
Right 1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG 0: 3
1: 53
2: 225
3: 664
4: 1531
1146091886_1146091893 3 Left 1146091886 17:29887531-29887553 CCTACCCCTTATCTGTGCCTCTA 0: 1
1: 0
2: 28
3: 146
4: 278
Right 1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG 0: 3
1: 53
2: 225
3: 664
4: 1531
1146091884_1146091893 21 Left 1146091884 17:29887513-29887535 CCTGGATTCTAATCCTGTCCTAC 0: 1
1: 0
2: 2
3: 24
4: 205
Right 1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG 0: 3
1: 53
2: 225
3: 664
4: 1531
1146091889_1146091893 -3 Left 1146091889 17:29887537-29887559 CCTTATCTGTGCCTCTATTTCCT 0: 1
1: 1
2: 28
3: 277
4: 1445
Right 1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG 0: 3
1: 53
2: 225
3: 664
4: 1531
1146091885_1146091893 8 Left 1146091885 17:29887526-29887548 CCTGTCCTACCCCTTATCTGTGC 0: 1
1: 0
2: 0
3: 17
4: 153
Right 1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG 0: 3
1: 53
2: 225
3: 664
4: 1531
1146091887_1146091893 -1 Left 1146091887 17:29887535-29887557 CCCCTTATCTGTGCCTCTATTTC 0: 1
1: 0
2: 2
3: 69
4: 521
Right 1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG 0: 3
1: 53
2: 225
3: 664
4: 1531

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146091893 Original CRISPR CCTCATCTGTAAAATGAGGA TGG Intronic
Too many off-targets to display for this crispr