ID: 1146106203

View in Genome Browser
Species Human (GRCh38)
Location 17:30039567-30039589
Sequence GGTACCAAGATACCCCAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 1, 2: 1, 3: 8, 4: 54}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146106193_1146106203 24 Left 1146106193 17:30039520-30039542 CCACTCCAGGGAGACCACTGCCA 0: 1
1: 1
2: 1
3: 20
4: 258
Right 1146106203 17:30039567-30039589 GGTACCAAGATACCCCAAGTTGG 0: 1
1: 1
2: 1
3: 8
4: 54
1146106201_1146106203 -1 Left 1146106201 17:30039545-30039567 CCTGCATCTTGCTTGTGGTGGAG 0: 1
1: 0
2: 0
3: 13
4: 156
Right 1146106203 17:30039567-30039589 GGTACCAAGATACCCCAAGTTGG 0: 1
1: 1
2: 1
3: 8
4: 54
1146106196_1146106203 4 Left 1146106196 17:30039540-30039562 CCACCCCTGCATCTTGCTTGTGG 0: 1
1: 0
2: 1
3: 19
4: 236
Right 1146106203 17:30039567-30039589 GGTACCAAGATACCCCAAGTTGG 0: 1
1: 1
2: 1
3: 8
4: 54
1146106192_1146106203 30 Left 1146106192 17:30039514-30039536 CCTCTGCCACTCCAGGGAGACCA 0: 1
1: 0
2: 5
3: 31
4: 381
Right 1146106203 17:30039567-30039589 GGTACCAAGATACCCCAAGTTGG 0: 1
1: 1
2: 1
3: 8
4: 54
1146106194_1146106203 19 Left 1146106194 17:30039525-30039547 CCAGGGAGACCACTGCCACCCCT 0: 1
1: 1
2: 6
3: 26
4: 406
Right 1146106203 17:30039567-30039589 GGTACCAAGATACCCCAAGTTGG 0: 1
1: 1
2: 1
3: 8
4: 54
1146106198_1146106203 1 Left 1146106198 17:30039543-30039565 CCCCTGCATCTTGCTTGTGGTGG 0: 1
1: 0
2: 1
3: 16
4: 219
Right 1146106203 17:30039567-30039589 GGTACCAAGATACCCCAAGTTGG 0: 1
1: 1
2: 1
3: 8
4: 54
1146106195_1146106203 10 Left 1146106195 17:30039534-30039556 CCACTGCCACCCCTGCATCTTGC 0: 1
1: 1
2: 5
3: 48
4: 521
Right 1146106203 17:30039567-30039589 GGTACCAAGATACCCCAAGTTGG 0: 1
1: 1
2: 1
3: 8
4: 54
1146106200_1146106203 0 Left 1146106200 17:30039544-30039566 CCCTGCATCTTGCTTGTGGTGGA 0: 1
1: 0
2: 0
3: 14
4: 142
Right 1146106203 17:30039567-30039589 GGTACCAAGATACCCCAAGTTGG 0: 1
1: 1
2: 1
3: 8
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146106203 Original CRISPR GGTACCAAGATACCCCAAGT TGG Intronic
920079994 1:203366066-203366088 GGTACAAAGATACACAAAGAAGG - Intergenic
1065678096 10:28199477-28199499 TGTAGCCAGATACCCCAAGGTGG + Intronic
1067101612 10:43338557-43338579 GGTGCCAAGATACCAAAAGGAGG + Intergenic
1077539705 11:3140752-3140774 GGTACCCACATACCCCAAGGAGG - Intronic
1079256895 11:18838332-18838354 GTTACCAAGATACCCTATATAGG + Intergenic
1083694906 11:64436402-64436424 TGGACCAAGAGACCCCAAGCTGG + Intergenic
1095461242 12:42446426-42446448 GGGACTAACATACCCCCAGTGGG + Intronic
1104203543 12:126615076-126615098 GGTATCAAGGCACCCCAAGTTGG - Intergenic
1104293733 12:127492974-127492996 GGTACCATGTTACCCTAAGAGGG - Intergenic
1111168485 13:84493973-84493995 GGTACCAACTTTCACCAAGTAGG + Intergenic
1112109303 13:96276888-96276910 GCTACCAAGATACTGCAAGCTGG + Intronic
1115628306 14:35217707-35217729 GGTACCAAGATAATTCAAGTAGG - Intronic
1146106203 17:30039567-30039589 GGTACCAAGATACCCCAAGTTGG + Intronic
1154017754 18:10635485-10635507 GGTACCAATATACACCTACTAGG + Intergenic
1159431984 18:68363671-68363693 CGTCCTAAGATAACCCAAGTAGG + Intergenic
1168675432 19:58274601-58274623 GGTAACAACATACCACAAATGGG - Intronic
927193320 2:20531791-20531813 GGTTCCCAGATCCCCCAGGTTGG - Intergenic
928312982 2:30225570-30225592 GGTATCAGGCTACCCCAAGGAGG + Intergenic
929366241 2:41159917-41159939 TGTAACAAGTGACCCCAAGTTGG + Intergenic
936981530 2:118269521-118269543 GCTACTATGATAACCCAAGTAGG - Intergenic
937141880 2:119609094-119609116 GGTGCCAAGATAGCCCCTGTAGG + Intronic
944992333 2:205252674-205252696 GATACCAAGTTAAGCCAAGTAGG + Intronic
947735978 2:232455797-232455819 GGCACCCATATACACCAAGTGGG + Intergenic
948369496 2:237479382-237479404 GGTCCCAGTATAGCCCAAGTGGG - Intergenic
948530293 2:238599793-238599815 GCTACCAGGCTACCCCAAGGAGG - Intergenic
1173071414 20:39771456-39771478 GATACTGAGATACTCCAAGTAGG + Intergenic
1184875867 22:47275139-47275161 GGCACCAACATTCCCCAAGAAGG - Intergenic
949263850 3:2134591-2134613 GAGACCAAGATGCCCCTAGTTGG - Intronic
954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG + Intronic
962986335 3:140539610-140539632 GGTGCCAAGAAACCCCAGGATGG - Intronic
965813348 3:172613929-172613951 GGAAACGAGATACCCCATGTGGG - Intergenic
971397793 4:26245828-26245850 GGTACCAAGATAATTCAAGGAGG - Intronic
996537828 5:124596675-124596697 GGTTCACAGATAACCCAAGTGGG + Intergenic
996865692 5:128119070-128119092 GGTACCAAGAATCCCTGAGTTGG + Intronic
1004168221 6:13275344-13275366 GGTACCAAGACAACCCCATTAGG - Intronic
1004491031 6:16116509-16116531 GCTACCAATATAATCCAAGTAGG - Intergenic
1008617467 6:53240462-53240484 GGCAACAAGAAACCCCAAGTGGG + Intergenic
1012586608 6:100930965-100930987 AGTACCAAGATCACCCAACTAGG - Intergenic
1012639760 6:101595045-101595067 GGTACCGAGAAACCTCAAGTAGG + Intronic
1016250142 6:142031100-142031122 GGGACCAAGATAAAACAAGTGGG + Intergenic
1016266275 6:142235660-142235682 TGTACCAAAATACCACAAATCGG - Intergenic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1021737899 7:23657155-23657177 GGTATGAAGGCACCCCAAGTTGG + Intergenic
1022817024 7:33923593-33923615 GGGACCAAGATACCCCAGGATGG - Intronic
1023317520 7:38955483-38955505 GGTGCATAGATACTCCAAGTGGG - Intergenic
1023470910 7:40518156-40518178 GATACCAAGAGAACCCAAGATGG + Intronic
1023489714 7:40726021-40726043 GGCACCAGGCTGCCCCAAGTCGG + Intronic
1030171685 7:106609057-106609079 GGTAGCAAGATCCCTCATGTGGG + Intergenic
1031041754 7:116845547-116845569 GCAACCAAGATACCCCCAGTAGG + Intronic
1031933525 7:127712008-127712030 GGGACCAAAATAACCCAAGAAGG - Intronic
1034706590 7:153151346-153151368 GGTAAAAAAATCCCCCAAGTTGG + Intergenic
1040621942 8:49101312-49101334 GGTACCAAGATACCCCAAATTGG + Intergenic
1044848052 8:96400902-96400924 GCAACCAAGATATCCCCAGTAGG + Intergenic
1045070314 8:98497176-98497198 GGTACCAAGATAACTCAATGAGG + Intronic
1045681760 8:104668158-104668180 GGTTCCAAGAAAGGCCAAGTGGG - Intronic
1048191031 8:132289332-132289354 TGTAACAAGTTACCCAAAGTTGG + Intronic
1050616398 9:7405744-7405766 GGTTGCTAGATACCTCAAGTTGG + Intergenic
1059063066 9:111053642-111053664 AGTACCAAGAGGCACCAAGTGGG - Intergenic
1187007646 X:15248117-15248139 GGAACAAAGACACCTCAAGTTGG - Intronic
1190101268 X:47524361-47524383 GTTATCAAGTCACCCCAAGTGGG + Intergenic
1192332536 X:70188145-70188167 GGTACCAATATGACCTAAGTGGG - Intronic
1194011875 X:88571826-88571848 GGTACCATGATACCCAAAGATGG - Intergenic
1197596962 X:128476495-128476517 AGGACAAAGATACCCAAAGTAGG + Intergenic
1198423129 X:136487795-136487817 GGTCCCAAGATTCCCCAACAGGG + Intergenic
1202116560 Y:21474151-21474173 GGGCCCATGTTACCCCAAGTTGG + Intergenic