ID: 1146109235

View in Genome Browser
Species Human (GRCh38)
Location 17:30072986-30073008
Sequence GAACTCCCATTGTCTAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146109235_1146109236 -5 Left 1146109235 17:30072986-30073008 CCAGTTTTAGACAATGGGAGTTC 0: 1
1: 0
2: 0
3: 14
4: 151
Right 1146109236 17:30073004-30073026 AGTTCTTTCACTCTGCACTCTGG 0: 1
1: 0
2: 0
3: 20
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146109235 Original CRISPR GAACTCCCATTGTCTAAAAC TGG (reversed) Intronic
905488347 1:38323786-38323808 GCATTCCAATTGTATAAAACAGG + Intergenic
908954752 1:69609675-69609697 GTTCTCACATTGGCTAAAACAGG - Intronic
909960397 1:81833464-81833486 AAACTACAATTTTCTAAAACTGG - Intronic
910462229 1:87459931-87459953 CAAATCTCATTGTCTAAATCAGG - Intergenic
910909696 1:92219995-92220017 GAGCTCCCAATGGCTAAAGCTGG - Intronic
911286813 1:96004882-96004904 GAATTCCCAATGGCAAAAACTGG - Intergenic
912577764 1:110690392-110690414 GAAGTCCCATTATCTATAATTGG - Intergenic
916469715 1:165111430-165111452 GAACTCCCACTCTTTAACACTGG + Intergenic
921397624 1:214685347-214685369 GAGCTCCCAGTGTCCAAAGCTGG - Intergenic
923504866 1:234596564-234596586 GAACTGCCATTTTGTAAAATGGG + Intergenic
1064804268 10:19112882-19112904 CAACTGCCAATGACTAAAACAGG - Intronic
1065154421 10:22854861-22854883 GAAGTCCCATTTTCTAATCCTGG + Intergenic
1068351104 10:55846281-55846303 GAACTTGCATGTTCTAAAACAGG - Intergenic
1072105886 10:92273523-92273545 GAATACCCATTCTCTAAAAAAGG + Intronic
1072288113 10:93936414-93936436 GGATTCCCATTGTCCAAATCAGG + Intronic
1072770148 10:98131297-98131319 AAACTACCAATGGCTAAAACCGG + Intergenic
1074697980 10:116067998-116068020 GTAGTCCCATTGGCTAAAGCTGG + Intronic
1080399635 11:31922056-31922078 GAACCCCCGTTCTCTAAAACAGG - Intronic
1082622722 11:55443890-55443912 GAAGGCCCATTGTCTAATAGTGG + Intergenic
1084731764 11:71078231-71078253 GGACACCCACTGGCTAAAACTGG + Intronic
1085415644 11:76317589-76317611 GACTTCCCATGCTCTAAAACAGG + Intergenic
1088697458 11:112380559-112380581 GAACTTCCAGTGTTAAAAACAGG + Intergenic
1094433363 12:30395059-30395081 GAGCTAGCATTGGCTAAAACAGG + Intergenic
1095576565 12:43747250-43747272 GAATTTCCATTTTCAAAAACAGG + Intronic
1095781340 12:46063842-46063864 GAGCTCCCAATGGCCAAAACTGG + Intergenic
1097329011 12:58312891-58312913 GAACCCCAAATATCTAAAACAGG + Intergenic
1099563085 12:84203847-84203869 GAACTCCCAATGGCCAAAGCTGG - Intergenic
1099621834 12:85012030-85012052 GAATTACCATTTTCTAAAATGGG - Intergenic
1101053686 12:100890182-100890204 AAACTCCCATTTTGTAAAAGAGG + Intronic
1102493270 12:113302008-113302030 CAACTCCCGTTCTCTAGAACTGG + Intronic
1106054530 13:26226097-26226119 GAATTTCCCTTGGCTAAAACAGG - Intergenic
1106128140 13:26917668-26917690 GAACTCCCATCGGCCAAATCTGG - Intergenic
1107732115 13:43358783-43358805 GAACCCCCGTTGTCTAACAGCGG + Intronic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1109719974 13:66263409-66263431 GAACCCCCAGTGTGTAGAACAGG + Intergenic
1109761985 13:66842734-66842756 GAATTCCCATTACCCAAAACAGG - Intronic
1110701038 13:78549353-78549375 GAACTCCCAATGACCAAAGCTGG + Intergenic
1112707330 13:102085464-102085486 TCACTCCCATTGTTTATAACAGG - Intronic
1117810283 14:59538131-59538153 GATCTCCTGTTGTCTGAAACTGG + Exonic
1118683141 14:68264137-68264159 GAACTCCTATTGCTTAAAACAGG + Intronic
1119013670 14:71025264-71025286 GGACTCCCAATGGCTAAATCAGG - Intronic
1119817534 14:77583337-77583359 ACACTCCCATTGCCTAGAACTGG - Intronic
1120698771 14:87674720-87674742 GAACTCCCAGTGGCCAAAGCTGG - Intergenic
1120716111 14:87842365-87842387 GAACTCCCAATGGCCAAAGCTGG - Intronic
1122180714 14:99952566-99952588 GAACTCCCAAAGTTTGAAACAGG + Intergenic
1122565065 14:102648009-102648031 GAAATCCCATTGGCCAAATCTGG - Intronic
1122565383 14:102650951-102650973 TAAGTCTCATTGTCTAATACAGG - Intronic
1122709148 14:103642700-103642722 GAGCTCCCATTGACAAAAGCTGG + Intronic
1124613215 15:31223385-31223407 AAACTCCCATTGGCTAAATTAGG - Intergenic
1124694633 15:31853728-31853750 GAATTCCCTTTGTCTAAGGCAGG - Intronic
1127322483 15:57860725-57860747 GAACTCCCAATGACCAAAGCTGG - Intergenic
1127580617 15:60336089-60336111 GAACTCCCAATGGCCAAAGCTGG + Intergenic
1128591739 15:68904084-68904106 GAGTTCCCATTGGCCAAAACAGG - Intronic
1129920481 15:79315347-79315369 AAAGTTCCATTGTCCAAAACTGG + Intronic
1130672067 15:85921372-85921394 GAACTCCCTTTCTCTCAAAAGGG + Intergenic
1135046431 16:19159673-19159695 GATGTTCCATTGGCTAAAACAGG - Intronic
1137225513 16:46503208-46503230 GAACTCACATTTTCTAATTCAGG + Intergenic
1137741433 16:50779921-50779943 GAACTCACATGGTCTAGAAGTGG + Exonic
1142173129 16:88633248-88633270 GAATTCCCATTCTCTGAAAAGGG + Intergenic
1143630243 17:8135121-8135143 GGGCTCCCATTGGCTAAATCTGG - Intergenic
1144234194 17:13241165-13241187 GAACTCTCTTTCTCTGAAACTGG - Intergenic
1144771698 17:17763085-17763107 CAACTTGCATTGTCTAAAACAGG + Intronic
1145779862 17:27555434-27555456 GAACTCCCAATGGCCAAAGCTGG - Intronic
1146109235 17:30072986-30073008 GAACTCCCATTGTCTAAAACTGG - Intronic
1147486616 17:40821391-40821413 GAAATCACATAGTCTAAAAGAGG - Intronic
1148532800 17:48410984-48411006 GAGCTCCCAGTGGCCAAAACTGG + Intronic
1149446218 17:56715289-56715311 TATCTCCCATTGTCTTACACAGG + Intergenic
1151098687 17:71530513-71530535 CAACACCCATAATCTAAAACTGG + Intergenic
1151179354 17:72315025-72315047 GAACTCCCAATGGCCAAAGCTGG - Intergenic
1156478588 18:37421993-37422015 GAACTCTCATTTTCAAAAGCTGG + Intronic
1157038966 18:44014791-44014813 GGACTCCCACTGTCCAAATCTGG - Intergenic
1161082301 19:2317349-2317371 GAAGTCCCAGTGCCTAAAAGAGG - Intronic
1161440471 19:4288653-4288675 GGACTCCCCTTGTCCAAAAATGG + Intronic
1167120991 19:47516404-47516426 GAACTCCCAATGGCCAAAGCTGG + Intergenic
925015444 2:520886-520908 GGACTCCCATTGTCTTCAAGGGG + Intergenic
925304512 2:2838756-2838778 GCCCACCCATTGTCTAAACCAGG - Intergenic
927213435 2:20652416-20652438 GAACTCCCTTTCTCTAAAGTAGG - Intergenic
928324777 2:30310840-30310862 GAACTCACATTTTTTAAAAAGGG - Intronic
929494408 2:42427638-42427660 GAACTATCATTGTATAAAAATGG + Intergenic
929623023 2:43376899-43376921 AAACTCCCAGTGTCTGACACTGG - Intronic
930756165 2:54975463-54975485 GCACCCCCATTATCTAAAGCGGG + Intronic
933379917 2:81529237-81529259 GAAGTCCCCTTGTCTAGAAGTGG - Intergenic
937585736 2:123546755-123546777 GAACTCCCATTAACCTAAACTGG + Intergenic
938658068 2:133456136-133456158 GAACTCCCAATGTCTGCTACAGG - Intronic
942325578 2:174774108-174774130 TAACTACTATTGTCTTAAACAGG - Intergenic
942687773 2:178551887-178551909 GAAGTCACATTGTATATAACTGG + Exonic
943494511 2:188604564-188604586 GACCTTCCATTGTCTAAAGATGG + Intergenic
944062579 2:195584741-195584763 TAACTCTCATTATCTAAAACTGG - Intronic
944598048 2:201280298-201280320 GAACTCTTATTGTCAAAAATTGG - Intronic
944725954 2:202471144-202471166 GAACTCCCACTGGCTAAATCTGG + Intronic
945448940 2:209971521-209971543 GATTTACCATTCTCTAAAACTGG - Intronic
945868790 2:215204782-215204804 GAACCCCAAATATCTAAAACAGG - Intergenic
946318946 2:218937265-218937287 GAGCTCCCATTGGCCAAATCTGG + Intergenic
946443659 2:219719093-219719115 GAACTCCCACTGGCTAAATCTGG + Intergenic
947074126 2:226323278-226323300 GAACTCCCAATGGCCAAAGCTGG + Intergenic
1169808385 20:9582879-9582901 GAACTCCCAGTGACAAAAGCTGG - Intronic
1170656716 20:18293567-18293589 GAGCTCCCAATGTTTAAAGCTGG + Intronic
1170795065 20:19540027-19540049 GAATTCCTATTGCCCAAAACAGG - Intronic
1171273519 20:23835092-23835114 GAAGTCCCATTGGCCAAAGCAGG + Intergenic
1174059860 20:47825257-47825279 GGACTCCCAATGTACAAAACAGG + Intergenic
1175329845 20:58155988-58156010 TAACCCCCATTGTATAAGACAGG - Intronic
1181903653 22:26175739-26175761 GAACTCACATTGTATAAAATTGG + Intronic
952812299 3:37415170-37415192 CAAAACTCATTGTCTAAAACTGG - Intronic
952812856 3:37420578-37420600 CAAAACTCATTGTCTAAAACTGG - Intronic
952950200 3:38517327-38517349 GAGCTCCCACTGGCTAAATCTGG - Intronic
955244996 3:57216988-57217010 GGACTCCCATTGGCCAAATCTGG - Intronic
955693782 3:61615742-61615764 GAACTCCCACTATCTAAATGTGG - Intronic
960649775 3:119933943-119933965 GAACTCCCAGTGGCCAAACCTGG + Intronic
961740479 3:129030490-129030512 TGAGTCCCATTGGCTAAAACTGG + Intronic
961883146 3:130077303-130077325 AAACACTGATTGTCTAAAACGGG + Intergenic
962069881 3:132022238-132022260 GAACTCCTTTTCTCTAAAGCAGG - Intronic
965330373 3:167366052-167366074 GAATTTCCATTTTCTGAAACAGG - Intronic
967077785 3:186020135-186020157 GAACTCCCAATGGCCAAAGCTGG - Intergenic
967659511 3:192089256-192089278 GAACAACCATTTTCTAAAATTGG + Intergenic
969602947 4:8187919-8187941 GAGCTCCCAGTGGCCAAAACTGG - Intronic
973286597 4:48424688-48424710 GAAATCACATTTTGTAAAACTGG + Exonic
977525965 4:98145248-98145270 GAACTCCCTTTGTCTAAATTAGG - Intergenic
978194598 4:105956384-105956406 GATCTCCCTTTTTATAAAACAGG + Intronic
980188418 4:129492517-129492539 TAACTCCCAATGGCTAAAGCTGG - Intergenic
980710333 4:136557866-136557888 GAACTTTCATTATATAAAACAGG - Intergenic
980994259 4:139765255-139765277 GTATGCACATTGTCTAAAACTGG + Intronic
984992162 4:185391596-185391618 GAGCTCCCAATGGCCAAAACTGG - Intronic
993602298 5:89942184-89942206 GAGCTCCCATTGGCCAAATCTGG + Intergenic
997807883 5:136937497-136937519 GGACTCCCACTGTCCAAAGCTGG + Intergenic
999744004 5:154577789-154577811 TGATTCCCAATGTCTAAAACAGG + Intergenic
1000465853 5:161575576-161575598 GAGCTCCCAATGGCCAAAACTGG + Intronic
1001100436 5:168809677-168809699 GTACTCTCAGTGCCTAAAACAGG + Intronic
1001870321 5:175148694-175148716 GATCTCCCAATGGCTAAAGCTGG + Intergenic
1006274960 6:32997022-32997044 GAGCTTCCATTGGCCAAAACTGG - Intergenic
1010215121 6:73394672-73394694 GAAAACCGATTGGCTAAAACTGG + Intronic
1010990740 6:82477411-82477433 GAAATCCAATTGTTTAAAAGAGG - Intergenic
1012059012 6:94453485-94453507 GTACAGCCACTGTCTAAAACAGG + Intergenic
1012790045 6:103681755-103681777 GGACTCCCATTGGCTAAATTTGG + Intergenic
1014269057 6:119315377-119315399 GAATTCTCATTTTTTAAAACTGG - Intronic
1015782151 6:136879726-136879748 GAACTCCCATTATGTATAAAAGG + Intronic
1017733165 6:157336303-157336325 GATATCCCATTGTTTAAAAAGGG + Intergenic
1020571472 7:9868831-9868853 GAACCCCCATTGGCCAAAACTGG + Intergenic
1020756023 7:12203844-12203866 GAACTCCCAATGGCCAAAACTGG - Intergenic
1021943135 7:25699525-25699547 GACATTCCATTGGCTAAAACTGG + Intergenic
1026235856 7:68526866-68526888 GAGCTCCCAGTGTCCAGAACTGG - Intergenic
1027499938 7:78937189-78937211 GAAATCCCAATGTCCAAATCTGG + Intronic
1027552188 7:79612824-79612846 AACATCCCATTGTCTAGAACAGG + Intergenic
1027642612 7:80755992-80756014 GAACTCCCACTCTTTAAACCAGG - Intronic
1031189629 7:118531019-118531041 GAAATACAATTGTCTAAATCAGG - Intergenic
1032996712 7:137455101-137455123 TGTCTCCCATTTTCTAAAACTGG - Intronic
1037163562 8:15800011-15800033 GAACCCCAATTGTTTATAACGGG + Intergenic
1043910197 8:85855136-85855158 GAACTCCCCTTGTCTAGATCTGG - Intergenic
1045415203 8:101959607-101959629 GACCTCCCACTGGCTAAATCTGG - Intronic
1045866621 8:106873664-106873686 GAATTCCCATTGGCTAAATCAGG - Intergenic
1048784278 8:138034050-138034072 GAACTCCCAGGGACAAAAACTGG - Intergenic
1048914508 8:139168839-139168861 GACATCCCATTGCCTAGAACAGG + Intergenic
1051425206 9:16925300-16925322 AAACTACAATTGTCTAAAAGAGG + Intergenic
1051961412 9:22768552-22768574 GAGCTCCCATTGTCCAAAGCTGG - Intergenic
1052275469 9:26670901-26670923 GAACTCCCATAATATGAAACTGG + Intergenic
1052415194 9:28168823-28168845 CAACTCCCATTGTGTGAAAATGG - Intronic
1055746400 9:79450297-79450319 GCACTCCCAATGTCCAAAGCTGG - Intergenic
1055805309 9:80086431-80086453 TAACTTTCATTGTCAAAAACAGG + Intergenic
1056686499 9:88767764-88767786 GAGCTCCCAATGGCCAAAACTGG - Intergenic
1056898515 9:90575501-90575523 AAACTCCCAGTGGCCAAAACTGG + Intergenic
1059125425 9:111680176-111680198 GAGCTCCCAGTGGCTAAACCTGG + Intergenic
1185774445 X:2791306-2791328 GAACTCCCAATGGTTAAAGCAGG - Intronic
1188126740 X:26377566-26377588 TAACTCAAATGGTCTAAAACGGG + Intergenic
1189674599 X:43448615-43448637 TAACTCCCAATGGCTAAATCTGG + Intergenic
1197276391 X:124484600-124484622 GAGCTCCCAATGGCTAAAGCTGG - Intronic
1199607722 X:149589462-149589484 GAACTTCCATTTCCTAAAATTGG - Intergenic
1199631401 X:149779905-149779927 GAACTTCCATTTCCTAAAATTGG + Intergenic