ID: 1146109568

View in Genome Browser
Species Human (GRCh38)
Location 17:30075842-30075864
Sequence TGATCCTAAAGCCATTAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 6, 3: 35, 4: 139}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146109568_1146109574 8 Left 1146109568 17:30075842-30075864 CCCACCTAATGGCTTTAGGATCA 0: 1
1: 0
2: 6
3: 35
4: 139
Right 1146109574 17:30075873-30075895 AAGGAGGCAAAAGAATGAAAGGG 0: 1
1: 1
2: 13
3: 164
4: 1690
1146109568_1146109576 27 Left 1146109568 17:30075842-30075864 CCCACCTAATGGCTTTAGGATCA 0: 1
1: 0
2: 6
3: 35
4: 139
Right 1146109576 17:30075892-30075914 AGGGGAAAAAGAAGAAGAAATGG 0: 1
1: 3
2: 56
3: 650
4: 4480
1146109568_1146109575 9 Left 1146109568 17:30075842-30075864 CCCACCTAATGGCTTTAGGATCA 0: 1
1: 0
2: 6
3: 35
4: 139
Right 1146109575 17:30075874-30075896 AGGAGGCAAAAGAATGAAAGGGG 0: 1
1: 0
2: 4
3: 103
4: 1026
1146109568_1146109573 7 Left 1146109568 17:30075842-30075864 CCCACCTAATGGCTTTAGGATCA 0: 1
1: 0
2: 6
3: 35
4: 139
Right 1146109573 17:30075872-30075894 CAAGGAGGCAAAAGAATGAAAGG 0: 1
1: 0
2: 4
3: 62
4: 674
1146109568_1146109572 -8 Left 1146109568 17:30075842-30075864 CCCACCTAATGGCTTTAGGATCA 0: 1
1: 0
2: 6
3: 35
4: 139
Right 1146109572 17:30075857-30075879 TAGGATCAAATTGTTCAAGGAGG 0: 1
1: 0
2: 0
3: 7
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146109568 Original CRISPR TGATCCTAAAGCCATTAGGT GGG (reversed) Intronic
903409864 1:23133352-23133374 GGATGCTAAAACCATTTGGTTGG + Intronic
908220610 1:62002148-62002170 TGATCCCAAAGCCTCTAGGTAGG - Intronic
908873164 1:68637982-68638004 TGACCCTGAAGCCACTATGTTGG + Intergenic
908930457 1:69311904-69311926 TGATCCTACTGGCATCAGGTTGG - Intergenic
909736930 1:78972810-78972832 TGATACAAAAGACATTTGGTGGG - Intronic
910400269 1:86831228-86831250 TCCTCAAAAAGCCATTAGGTAGG + Intergenic
911497388 1:98648221-98648243 TGACCCTAAAGCCATTTTGGAGG - Intergenic
911607177 1:99919984-99920006 TCATCCTGAAGTCATTAGGTGGG - Intronic
912546871 1:110457318-110457340 TTATTCTAAAGCCAGCAGGTTGG - Exonic
915544067 1:156586028-156586050 TGGCCCTCAAGCCAATAGGTGGG + Exonic
915928919 1:160046279-160046301 TGATCCTCACACCATGAGGTAGG + Intronic
918168813 1:181975549-181975571 TGATCCTACTGGCATCAGGTTGG + Intergenic
919586552 1:199447552-199447574 TGATCCTACTGGCATCAGGTTGG - Intergenic
920448306 1:206037164-206037186 TGATCCTAAGCCTGTTAGGTGGG + Intergenic
1067436105 10:46279691-46279713 TGATTATAATGCGATTAGGTTGG - Intergenic
1070211005 10:74321521-74321543 TGATCCTCAAGACATTAGCTTGG + Intronic
1070506190 10:77115037-77115059 TGATCCTAAAGCACTTAGGATGG - Intronic
1071049912 10:81434879-81434901 CAATCCTAAATCCATTAGGTGGG + Intergenic
1071134491 10:82437956-82437978 TGATCCTACTGGCATCAGGTTGG - Intronic
1076165623 10:128280229-128280251 TGAACCTCTAGACATTAGGTAGG - Intergenic
1080618461 11:33966578-33966600 TAATCCTAATGCTATGAGGTAGG + Intergenic
1081905438 11:46666530-46666552 AAATCCTAAAGACATTAGATAGG + Intronic
1084131267 11:67137261-67137283 TTATCCTGAAGCCATTGGGAAGG + Intronic
1085983732 11:81758127-81758149 TGCTCTTAAAGCCATAGGGTTGG - Intergenic
1088633337 11:111795332-111795354 CAATCCTAAAGCCATTACGTGGG + Intronic
1088697802 11:112383107-112383129 TGATCCTACTGGCATTAGGTTGG + Intergenic
1088968521 11:114750162-114750184 TGATTCTAACACCTTTAGGTAGG - Intergenic
1089829950 11:121318473-121318495 CAGTCCTAAAGCCATCAGGTTGG + Intergenic
1090916467 11:131168405-131168427 TGATCCTACAGTCCTTAGCTAGG - Intergenic
1091832496 12:3559866-3559888 CCATGCTAAAGCCATGAGGTGGG - Intronic
1094243732 12:28261499-28261521 TGATGCCAAAGGCATTAGGGAGG + Intronic
1096860663 12:54525572-54525594 TGTTCCCAAAGCCCTAAGGTTGG + Intronic
1097119983 12:56724393-56724415 TAACCCTAAAGCCATTTGGTGGG - Intronic
1099196288 12:79620308-79620330 AAGTCCTAAAGCCATTAGGCAGG + Intronic
1101066606 12:101027912-101027934 TGATCCTACTGGCATCAGGTTGG + Intronic
1102054766 12:109888144-109888166 CAATCCAAAAGCCAATAGGTGGG - Intergenic
1109388355 13:61663576-61663598 TGCTTTTAAAGCCATAAGGTGGG - Intergenic
1109752013 13:66706839-66706861 TGATCCTGAAGCCAAGAGTTTGG + Intronic
1111941274 13:94610696-94610718 TGGACCTAAAACTATTAGGTTGG - Intronic
1114201592 14:20525959-20525981 TAGTCCTAAAGCCACCAGGTGGG - Intergenic
1114706047 14:24727246-24727268 TGATCCTACTGGCATCAGGTTGG + Intergenic
1115061095 14:29190998-29191020 AAGTCCAAAAGCCATTAGGTAGG - Intergenic
1117445619 14:55801201-55801223 TGTTCCAAAAGCCATTTGGTGGG + Intergenic
1118179255 14:63474797-63474819 TGGTCTTAAAGCCAATAGGCCGG + Intronic
1118369438 14:65124968-65124990 TTAGTCTAAAGCCATTAGGTTGG + Intergenic
1118478977 14:66144401-66144423 TGATCCTACTGGCATCAGGTTGG + Intergenic
1119988753 14:79170852-79170874 GTATCCTAAACCCATGAGGTTGG - Intronic
1121115059 14:91337732-91337754 TGATCATAATGCCATGAGGTGGG + Intronic
1124254103 15:28127176-28127198 TGGTCCTAAAGCCACGAGGCGGG + Intronic
1124656670 15:31514773-31514795 AAGTTCTAAAGCCATTAGGTGGG - Intronic
1125357455 15:38831330-38831352 CAGTGCTAAAGCCATTAGGTGGG - Intergenic
1126552921 15:49953116-49953138 TGATCCTACTGGCATCAGGTTGG - Intronic
1133058047 16:3157256-3157278 GGATCCTGAAGCCAGTTGGTTGG + Intergenic
1138345918 16:56320127-56320149 TGATCCTAAACCCATAAGAATGG + Intronic
1139261126 16:65594965-65594987 TGTTCCAAAGGCCATTTGGTAGG - Intergenic
1146109568 17:30075842-30075864 TGATCCTAAAGCCATTAGGTGGG - Intronic
1146437010 17:32859506-32859528 TGGTCCTAAAGCCATTGGGTTGG - Intronic
1149242090 17:54662905-54662927 TGATCCTACTGGCATCAGGTTGG - Intergenic
1151031991 17:70751974-70751996 TTATGATAAAGCCATTGGGTAGG + Intergenic
1152491117 17:80635363-80635385 CAATCCTAAAGCCACAAGGTGGG - Intronic
1155557972 18:27042735-27042757 TAATCCTTAGGCCATTAAGTTGG - Intronic
1158518663 18:58151861-58151883 TGACCCTGAAGCCATTGGGGTGG - Intronic
1163949584 19:20571567-20571589 TGATCCTACTGGCATCAGGTTGG - Intronic
1168601855 19:57724974-57724996 TTATCCTAAGGCCAGAAGGTAGG - Intronic
928879868 2:36086335-36086357 CCATCCCAAAGGCATTAGGTGGG + Intergenic
929370986 2:41223359-41223381 TGATCCTATTGGCATCAGGTTGG + Intergenic
930545853 2:52766233-52766255 TGATCCTACTGGCATCAGGTTGG + Intergenic
930684065 2:54288917-54288939 TGAAACTAAAGCCAGTAGGTGGG - Intronic
932328571 2:70882462-70882484 TCATCCAAAAGCCATTAGGTAGG + Intergenic
932444114 2:71762934-71762956 TCTTCCAGAAGCCATTAGGTGGG + Intergenic
932647136 2:73513950-73513972 CAATCTTAAAACCATTAGGTAGG - Intronic
933730371 2:85451712-85451734 TGATCTTAAAGCCATGAGCCTGG - Intergenic
934993681 2:98938202-98938224 TGATCCAAAAGGCATTAAGGAGG - Intergenic
937185898 2:120042244-120042266 TGATGCTAAAGCAAGGAGGTGGG - Intronic
937270755 2:120650051-120650073 TAGTTCTAAAGCCATTAGATGGG - Intergenic
938678382 2:133662582-133662604 TGATCACAATACCATTAGGTTGG + Intergenic
939737249 2:145862956-145862978 TGGTATTAAAGCCATTGGGTTGG - Intergenic
941703912 2:168637014-168637036 TGAGCTGAAAGCCATTAGTTAGG - Intronic
948498381 2:238370611-238370633 TGGTCCTGAAGCCATGAAGTGGG - Intronic
1170396183 20:15927852-15927874 TCTTCCTAAAGCCATTAAGCAGG + Intronic
1171372561 20:24670863-24670885 CGGCCCTAAAGCCATTAGTTAGG + Intergenic
1173762938 20:45579600-45579622 CAGTCCTAAAGCCATTAGATAGG - Intergenic
1176455231 21:6902342-6902364 GGATCCTGATGACATTAGGTTGG - Intergenic
1176833403 21:13767390-13767412 GGATCCTGATGACATTAGGTTGG - Intergenic
1176900493 21:14435858-14435880 TGACCCTAAAGCCATCATGCTGG - Intergenic
1179557222 21:42187521-42187543 TGGTCCTAAAGTCATGAGGTGGG + Intergenic
1180874728 22:19169822-19169844 GGATTCTGAAGCCATTAGGTGGG + Intergenic
1184491787 22:44814096-44814118 TCAGCCCAAAGCCATCAGGTTGG - Intronic
1203238156 22_KI270732v1_random:27998-28020 TGATCCCAAAGTCATTCGTTTGG - Intergenic
949119850 3:373010-373032 TGATCCTACTGCCAACAGGTTGG - Intronic
950845127 3:16008008-16008030 TCATCCTAATGCAATTTGGTGGG - Intergenic
951000655 3:17555556-17555578 TGATCCTGAAGAGATTAGCTGGG - Intronic
952503706 3:33988867-33988889 TGATCCTACTGGCATTAGGTTGG - Intergenic
954058361 3:48047400-48047422 TTAGCCTAAAGCCATCAGGTAGG + Intronic
955540839 3:59974408-59974430 TGGTGCTGAAGCCAGTAGGTAGG - Intronic
955690426 3:61585411-61585433 TGGTACTATAGCCATTGGGTGGG + Intronic
956189106 3:66591588-66591610 TGGACCTAAAACCATTAAGTAGG - Intergenic
958904141 3:99923579-99923601 TGTTCCAACAGCCATGAGGTTGG - Intronic
961705498 3:128782033-128782055 TGATCCTAAAACCGGAAGGTTGG + Intronic
962437918 3:135383439-135383461 TGCTCCTAATGCCACAAGGTGGG + Intergenic
965263408 3:166511186-166511208 TGATCCTACTGACATCAGGTTGG + Intergenic
966307587 3:178554072-178554094 TGATGATAAAGCTATGAGGTAGG + Intronic
966539555 3:181074764-181074786 TGATCCTACTGACATCAGGTTGG - Intergenic
969440988 4:7216692-7216714 TGGCCCTAAAGTCATTAGGAGGG - Intronic
971277100 4:25208931-25208953 TGATCCTGAAGAGATTAGCTGGG - Intronic
976163385 4:82227902-82227924 TGATCCCCAAGCCAATAGGTAGG - Intergenic
977508935 4:97937788-97937810 TGTTCCTACTGACATTAGGTTGG - Intronic
978206234 4:106083675-106083697 TGATCCTACTGGCATCAGGTTGG + Intronic
979583809 4:122391269-122391291 TGATCCTACCGGCATCAGGTTGG - Intronic
979775516 4:124583798-124583820 TGATCCTACAGGCATCAGGTTGG + Intergenic
981092314 4:140744483-140744505 TGATCCTAAAGAGATTAGCTAGG + Intronic
981919173 4:150068231-150068253 CAATCCTAAAGCCATTAGGTGGG + Intergenic
982663093 4:158229402-158229424 TGATCCTACTGGCATCAGGTTGG - Intronic
983139326 4:164129021-164129043 TGATTCAGAAGCCATTAGGTGGG - Intronic
983581538 4:169314357-169314379 TGATCCTGAACCCATGAGGAGGG + Intergenic
984640230 4:182157067-182157089 GGATGCTAGAACCATTAGGTTGG - Intronic
984677259 4:182564046-182564068 TCATCATAAAGACCTTAGGTTGG + Intronic
986596730 5:9430417-9430439 TGATACTAAAGCCATGAGACTGG + Intronic
992565108 5:77988353-77988375 TGACCCTCAAGACATCAGGTGGG - Intergenic
994075003 5:95640862-95640884 CAGTCCTAAAGCCAGTAGGTGGG + Intergenic
995666255 5:114545228-114545250 TGATCCTACTGGCATCAGGTTGG + Intergenic
995803947 5:116030194-116030216 AGAGTCTAAATCCATTAGGTTGG - Intronic
996546607 5:124685727-124685749 TGATCCTGAAACCTTGAGGTGGG + Intronic
997274384 5:132572239-132572261 CAGTCCAAAAGCCATTAGGTAGG + Intronic
998339143 5:141401000-141401022 AAATCATAAATCCATTAGGTAGG - Intronic
1005942753 6:30572994-30573016 TAATCCTAAAGACATTAAGAAGG + Intronic
1008246078 6:49175236-49175258 TAATCATAAAGCCATGAGCTAGG - Intergenic
1008653332 6:53585875-53585897 TGAACCAAAAGAAATTAGGTTGG - Intronic
1010549639 6:77205572-77205594 TTATCCAAAAGTCATTAGGGAGG - Intergenic
1010945696 6:81970638-81970660 TGATCCTACTGACATCAGGTTGG + Intergenic
1011022002 6:82825065-82825087 TAGTTCTAAAGCCATTAGGTAGG + Intergenic
1011476776 6:87756162-87756184 TGGTGCTAAAGCCTTTAGGTGGG - Intergenic
1018573259 6:165232848-165232870 TCATCCTGAAGCCATCAGGTTGG - Intergenic
1020696325 7:11418490-11418512 TGTTCCTAAATCCATTAAGTTGG - Intronic
1021194238 7:17657144-17657166 TCATCTCAAAGCCATTAGGATGG + Intergenic
1023221851 7:37927539-37927561 TTAGACTAAAGCCACTAGGTAGG - Intronic
1023363620 7:39441100-39441122 TGATCCTACTGGCATCAGGTTGG - Intronic
1024239965 7:47427198-47427220 TGATGCCAAAGACATTTGGTTGG - Intronic
1026389242 7:69883082-69883104 TGTTCGTAAAGCCAGAAGGTGGG + Intronic
1026519713 7:71106096-71106118 CAGTCCTAAAGCCATTAGGTAGG + Intergenic
1029309354 7:99647351-99647373 GAATACTAAAGCCATTAGGTGGG - Intergenic
1029312874 7:99683864-99683886 TTATCCTAAAGTCATTAGGTGGG - Intergenic
1029315023 7:99703989-99704011 TAGCCCTAGAGCCATTAGGTGGG - Intronic
1029320704 7:99756877-99756899 TAGTCCTAAAGCCATTAGGTGGG - Intergenic
1035395012 7:158529019-158529041 TGATCCCAAAGCCCCTTGGTGGG - Intronic
1035960701 8:4134284-4134306 TGAGGATAAAGCCTTTAGGTTGG + Intronic
1035960934 8:4137172-4137194 TGAGGCTAATGCTATTAGGTAGG - Intronic
1038188327 8:25295750-25295772 TGATTATAATGCCATGAGGTAGG - Intronic
1038280610 8:26160940-26160962 TAGCCCTAAAGCCATTAGGAGGG + Intergenic
1038285926 8:26206554-26206576 TTAACCTAAAGCCATGAGCTGGG - Intergenic
1038594258 8:28871727-28871749 TGATCCTAAAGCCATGATCTTGG + Intronic
1040778823 8:51081266-51081288 TGATCCTCAAGATACTAGGTTGG - Intergenic
1040903155 8:52438238-52438260 TTATCCTAATGAAATTAGGTAGG - Intronic
1041009422 8:53527200-53527222 TGATCCTAGAGCCTTCATGTGGG - Intergenic
1041231365 8:55756583-55756605 CAGTCCTACAGCCATTAGGTGGG + Intronic
1041431148 8:57782103-57782125 TGGTCTTAAATCCCTTAGGTTGG + Intergenic
1042060953 8:64817063-64817085 TAGTCCAAAAGCCAGTAGGTAGG - Intergenic
1043935717 8:86139618-86139640 TGATCGAAACGCCATTAGGTAGG + Exonic
1044722085 8:95160396-95160418 CAGCCCTAAAGCCATTAGGTGGG - Intergenic
1046337223 8:112806047-112806069 TGATGCTGAAGGCATTATGTAGG + Intronic
1047239977 8:123078111-123078133 TAGTCCGAAAGCAATTAGGTGGG + Intronic
1048028966 8:130613102-130613124 GGAGCCAAAAGCCATCAGGTGGG - Intergenic
1052155324 9:25180664-25180686 TAATCCTGAAGCCATTAGATGGG - Intergenic
1052943676 9:34150140-34150162 TGATCCCATAGCCAATTGGTAGG - Intergenic
1053341533 9:37339206-37339228 TAATTCTAAAGCCATTAGCTTGG + Intronic
1053611546 9:39718841-39718863 TGATCCCAAAGTCATTAGCTTGG + Intergenic
1053869580 9:42476896-42476918 TGATCCCAAAGTCATTAGCTTGG + Intergenic
1054086709 9:60752319-60752341 TGATCCCAAAGTCATTAGCTTGG - Intergenic
1054241975 9:62623547-62623569 TGATCCCAAAGTCATTAGCTTGG - Intergenic
1054556098 9:66658062-66658084 TGATCCCAAAGTCATTAGCTTGG - Intergenic
1058500536 9:105610815-105610837 CGATACTAAAACCATTAGATGGG - Intronic
1203582304 Un_KI270746v1:20776-20798 TGATCCCAAAGTCATTCGTTCGG - Intergenic
1185952564 X:4452371-4452393 TGATCCTACTGGCATCAGGTTGG + Intergenic
1186150950 X:6674077-6674099 TTATTCTAAAGCAATTATGTAGG - Intergenic
1186431016 X:9504026-9504048 TGATCCTACTGGCATCAGGTTGG + Intronic
1189170396 X:38903840-38903862 TAATCCTAAAGACATTAGGTGGG + Intergenic
1190529692 X:51362018-51362040 TGATCCTACCGGCATCAGGTTGG + Intergenic
1192181629 X:68919597-68919619 TGATTGTATAGCCATTAAGTGGG - Intergenic
1192952012 X:76026853-76026875 TGATCCTACTGGCATCAGGTTGG + Intergenic
1193062447 X:77220666-77220688 TGATCCTACTGGCATAAGGTTGG + Intergenic
1194060323 X:89188757-89188779 CAATCTAAAAGCCATTAGGTGGG + Intergenic