ID: 1146109569

View in Genome Browser
Species Human (GRCh38)
Location 17:30075843-30075865
Sequence TTGATCCTAAAGCCATTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 1, 2: 4, 3: 20, 4: 127}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146109569_1146109573 6 Left 1146109569 17:30075843-30075865 CCACCTAATGGCTTTAGGATCAA 0: 1
1: 1
2: 4
3: 20
4: 127
Right 1146109573 17:30075872-30075894 CAAGGAGGCAAAAGAATGAAAGG 0: 1
1: 0
2: 4
3: 62
4: 674
1146109569_1146109572 -9 Left 1146109569 17:30075843-30075865 CCACCTAATGGCTTTAGGATCAA 0: 1
1: 1
2: 4
3: 20
4: 127
Right 1146109572 17:30075857-30075879 TAGGATCAAATTGTTCAAGGAGG 0: 1
1: 0
2: 0
3: 7
4: 123
1146109569_1146109574 7 Left 1146109569 17:30075843-30075865 CCACCTAATGGCTTTAGGATCAA 0: 1
1: 1
2: 4
3: 20
4: 127
Right 1146109574 17:30075873-30075895 AAGGAGGCAAAAGAATGAAAGGG 0: 1
1: 1
2: 13
3: 164
4: 1690
1146109569_1146109575 8 Left 1146109569 17:30075843-30075865 CCACCTAATGGCTTTAGGATCAA 0: 1
1: 1
2: 4
3: 20
4: 127
Right 1146109575 17:30075874-30075896 AGGAGGCAAAAGAATGAAAGGGG 0: 1
1: 0
2: 4
3: 103
4: 1026
1146109569_1146109576 26 Left 1146109569 17:30075843-30075865 CCACCTAATGGCTTTAGGATCAA 0: 1
1: 1
2: 4
3: 20
4: 127
Right 1146109576 17:30075892-30075914 AGGGGAAAAAGAAGAAGAAATGG 0: 1
1: 3
2: 56
3: 650
4: 4480

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146109569 Original CRISPR TTGATCCTAAAGCCATTAGG TGG (reversed) Intronic
900583622 1:3421761-3421783 TTTATGCAAGAGCCATTAGGTGG + Intronic
901804084 1:11726756-11726778 TTGATCCTAAAGCCAAGGTGGGG + Intergenic
901819539 1:11818579-11818601 TTGATACTGAAGCCATAAAGTGG - Intronic
902245975 1:15120608-15120630 TTAATCCTAAAACCATCTGGAGG + Intergenic
911607178 1:99919985-99920007 TTCATCCTGAAGTCATTAGGTGG - Intronic
913672581 1:121111525-121111547 TTGATGCTGAAGCCATTGGAGGG + Intergenic
914024350 1:143898890-143898912 TTGATGCTGAAGCCATTGGAGGG + Intergenic
914662832 1:149806911-149806933 TTGATGCTGAAGCCATTGGAGGG + Intronic
915414796 1:155733391-155733413 TGGATACTAAAACCAGTAGGTGG - Intronic
917357327 1:174140524-174140546 TTGATCCCAAAGCCATTAGGTGG + Intergenic
922891955 1:229068386-229068408 TTGATCTTAAAGGCAGTAGTGGG + Intergenic
923816621 1:237386775-237386797 TTGATGCAAAAGCCATTAGATGG - Intronic
1067305725 10:45062302-45062324 TTGAAGCTAAAGCCATCACGTGG + Intergenic
1068275337 10:54788117-54788139 TTGACTCTAAAGCTATTAAGGGG + Intronic
1069541430 10:69297004-69297026 TTGACCCTGAAGCAATGAGGGGG + Intronic
1071049911 10:81434878-81434900 TCAATCCTAAATCCATTAGGTGG + Intergenic
1075805722 10:125187502-125187524 TTGATCCTAAAGTCTTTGAGTGG + Intergenic
1075915586 10:126163531-126163553 TTGATCTGAAAGCAATTTGGAGG - Intronic
1077457674 11:2690739-2690761 ATGATCCCAAATCCCTTAGGTGG + Intronic
1080306282 11:30840211-30840233 TTACTCCTAAATCCATTAGGTGG + Intronic
1080744843 11:35099617-35099639 GTGATTCTAAAGCCATTAAAGGG - Intergenic
1084223598 11:67700316-67700338 TTGGTCCCAGAGCCATTAGATGG - Intergenic
1084839645 11:71834908-71834930 TTGTTCCTAAAGCAAATAGCTGG + Intronic
1086279237 11:85166612-85166634 TTGTTCCTAAAGAGATCAGGTGG - Intronic
1086727989 11:90212656-90212678 TTTATCCTAAATTCATTTGGTGG - Intronic
1088633336 11:111795331-111795353 TCAATCCTAAAGCCATTACGTGG + Intronic
1088959324 11:114646380-114646402 TTTATCCTTAAGTCCTTAGGTGG + Intergenic
1089121656 11:116139899-116139921 TTGTACCCAAAGCCATTTGGAGG + Intergenic
1089434944 11:118457002-118457024 CAGATCCTATAGACATTAGGAGG - Intronic
1091832498 12:3559867-3559889 TCCATGCTAAAGCCATGAGGTGG - Intronic
1097119984 12:56724394-56724416 TTAACCCTAAAGCCATTTGGTGG - Intronic
1097916077 12:65021607-65021629 TTAGTCCTAAAGCCATTAGGTGG - Intergenic
1098813219 12:75122566-75122588 TTGATTCTAAAGCCATGTGGAGG - Intronic
1099093425 12:78341529-78341551 TTTATTCTATAGCTATTAGGGGG - Intergenic
1100105864 12:91171437-91171459 TTTATCCCAATACCATTAGGAGG + Intronic
1101346389 12:103890138-103890160 CTGATCATAAAGCCAGAAGGAGG - Intergenic
1102054767 12:109888145-109888167 TCAATCCAAAAGCCAATAGGTGG - Intergenic
1104756418 12:131272432-131272454 TTGATACAAAATCCATCAGGAGG - Intergenic
1109388356 13:61663577-61663599 TTGCTTTTAAAGCCATAAGGTGG - Intergenic
1112541299 13:100316077-100316099 TTAATCCTAAAGCCAAAAGAGGG - Intronic
1114201593 14:20525960-20525982 TTAGTCCTAAAGCCACCAGGTGG - Intergenic
1114607963 14:24013408-24013430 TTGGCCATAAAGCCATTAAGAGG - Intergenic
1117445618 14:55801200-55801222 ATGTTCCAAAAGCCATTTGGTGG + Intergenic
1118715427 14:68556431-68556453 TGGCTCCTAAAGCCATCAGGTGG + Intronic
1120567842 14:86081505-86081527 TTGGTACTAAAGGCATTAGAAGG + Intergenic
1121115058 14:91337731-91337753 GTGATCATAATGCCATGAGGTGG + Intronic
1124254102 15:28127175-28127197 TTGGTCCTAAAGCCACGAGGCGG + Intronic
1124656671 15:31514774-31514796 TAAGTTCTAAAGCCATTAGGTGG - Intronic
1125357456 15:38831331-38831353 TCAGTGCTAAAGCCATTAGGTGG - Intergenic
1128185691 15:65641908-65641930 TTGATGCTAAAGCCATGATCCGG + Intronic
1128359343 15:66949892-66949914 ATGGTTCAAAAGCCATTAGGTGG - Intergenic
1138943876 16:61823687-61823709 TTTATCCTAAGATCATTAGGAGG - Intronic
1141085188 16:81089123-81089145 TTGACCAAAATGCCATTAGGCGG - Intronic
1146109569 17:30075843-30075865 TTGATCCTAAAGCCATTAGGTGG - Intronic
1147275798 17:39315479-39315501 TCAGTTCTAAAGCCATTAGGAGG + Intronic
1151053326 17:71004262-71004284 GTGATCCTAAATCCATTACCTGG + Intergenic
1153491552 18:5654666-5654688 TTGATCCAATAGCCCTTAGAGGG + Intergenic
1155367113 18:25059572-25059594 TTGATCCTCCAGTAATTAGGAGG - Intergenic
1158168072 18:54564465-54564487 TAGATACTAAAGCTATTATGTGG - Intergenic
1159557390 18:69959710-69959732 TAGATGCTAAAACCATGAGGTGG + Intronic
1159799416 18:72879005-72879027 TTGATTCTAAACCAATTATGAGG + Intergenic
1164289644 19:23855856-23855878 TTGGTCCCAGAGCCATTAGGTGG + Intergenic
925253314 2:2461055-2461077 TTTATCTTAAAGCCAGTTGGAGG - Intergenic
928879866 2:36086334-36086356 TCCATCCCAAAGGCATTAGGTGG + Intergenic
930684066 2:54288918-54288940 ATGAAACTAAAGCCAGTAGGTGG - Intronic
932444113 2:71762933-71762955 TTCTTCCAGAAGCCATTAGGTGG + Intergenic
936235921 2:110742514-110742536 TGGATCCTGATGCCATTGGGTGG + Intronic
936902439 2:117497017-117497039 TTGATCTTAGAGACATTAAGCGG - Intergenic
939407789 2:141781154-141781176 TTCATCCACAAGCCATTGGGAGG + Intronic
939775545 2:146382867-146382889 TTGATCGTAACGTCATTATGGGG + Intergenic
939967851 2:148628157-148628179 TTGACCATATAGCCATTAGTAGG + Intergenic
940409327 2:153342120-153342142 TTAAACCTAAAGCCATTTGCAGG + Intergenic
941034327 2:160551169-160551191 TTGATCCTAATATCCTTAGGAGG - Intergenic
944648198 2:201801415-201801437 TGGATGCTAAAATCATTAGGTGG - Intronic
944912681 2:204325804-204325826 TTGAACCTTAAGCATTTAGGTGG - Intergenic
945194239 2:207223468-207223490 TTGATACTAGTGCCATTAAGGGG + Intergenic
945640743 2:212425881-212425903 TTGATTTTTAAGGCATTAGGTGG - Intronic
948498382 2:238370612-238370634 TTGGTCCTGAAGCCATGAAGTGG - Intronic
1170284641 20:14692870-14692892 TTCATCACAAAGCCATTTGGGGG - Intronic
1177900206 21:26905238-26905260 TTGATCTAAAAGCCAAAAGGAGG - Intergenic
1178779577 21:35588785-35588807 TTGATCAAAAAGTCATTATGGGG + Intronic
1179557221 21:42187520-42187542 TTGGTCCTAAAGTCATGAGGTGG + Intergenic
1179600442 21:42474184-42474206 TTGATCCTGAGCCCAGTAGGCGG - Intronic
1180874727 22:19169821-19169843 GGGATTCTGAAGCCATTAGGTGG + Intergenic
950690545 3:14652503-14652525 TACCTCCTAAAGCCATTGGGAGG - Intronic
953030016 3:39173455-39173477 CTGCTCCTAAAGCCATTGGCTGG + Intergenic
955690425 3:61585410-61585432 TTGGTACTATAGCCATTGGGTGG + Intronic
959540401 3:107531054-107531076 GTGATTCTAAAGCAAGTAGGAGG + Intronic
961082602 3:124039111-124039133 TTGACCCTGAAGGCACTAGGGGG - Intergenic
961971058 3:130968795-130968817 TTGATGCAAACGCTATTAGGAGG + Intronic
964089869 3:152862774-152862796 TTAGTCCTAAAGCCATTTGGTGG + Intergenic
964369021 3:155980290-155980312 TTGACCAAAAAGCCATTATGTGG + Intergenic
966109117 3:176375773-176375795 TGGATCATAAAGCCCATAGGAGG + Intergenic
968329357 3:197852298-197852320 GTGATACTAAAGCCATTAGAGGG + Intronic
969440989 4:7216693-7216715 GTGGCCCTAAAGTCATTAGGAGG - Intronic
972101644 4:35427441-35427463 TTTATACTAAAACCATTGGGAGG - Intergenic
973681655 4:53327038-53327060 TTAATCCAAAAGTCATTAGTTGG + Intronic
976883059 4:89953615-89953637 TTGATCCTAAAGAAATTTAGTGG + Exonic
978903784 4:113983028-113983050 TTGATTCTGAGGTCATTAGGAGG + Intergenic
981919172 4:150068230-150068252 CCAATCCTAAAGCCATTAGGTGG + Intergenic
982811718 4:159833811-159833833 TGGATCCTAAACTCATTTGGGGG + Intergenic
983139327 4:164129022-164129044 CTGATTCAGAAGCCATTAGGTGG - Intronic
983581537 4:169314356-169314378 ATGATCCTGAACCCATGAGGAGG + Intergenic
991445572 5:66696409-66696431 TTGATACTAAAACCCGTAGGAGG - Intronic
994075002 5:95640861-95640883 TCAGTCCTAAAGCCAGTAGGTGG + Intergenic
995539546 5:113171197-113171219 TTGAACCTAAAGACAAAAGGAGG + Intronic
999026719 5:148241835-148241857 TTGATCCTAAGGCCTTTTGTTGG + Intergenic
999118137 5:149183006-149183028 TTAATTCAAAAGCCATTTGGAGG + Intronic
1000988655 5:167888858-167888880 TTGATACTGAAGCATTTAGGCGG + Intronic
1005942938 6:30574579-30574601 TTAATCCTAAAGGCATTAGGAGG - Intronic
1006087948 6:31609911-31609933 TTGATTCAATAGCCATTAGTTGG - Intergenic
1006432134 6:34003498-34003520 TTGACCCTAAAGGCAGTGGGAGG - Intergenic
1011476777 6:87756163-87756185 TTGGTGCTAAAGCCTTTAGGTGG - Intergenic
1013185560 6:107754773-107754795 TAGATGTTAAAGTCATTAGGAGG - Intronic
1014292202 6:119571427-119571449 CTGATCCTACATCCATGAGGTGG + Intergenic
1016068921 6:139714168-139714190 TTGATTCAAAAGCAATGAGGAGG + Intergenic
1016973042 6:149783057-149783079 ATGAATCTAAAACCATTAGGAGG + Intronic
1021064181 7:16152739-16152761 TTATTCCCAAAGCCTTTAGGCGG + Intronic
1022026619 7:26453769-26453791 GTAATCCATAAGCCATTAGGTGG + Intergenic
1026189827 7:68115152-68115174 TTGATCCAAATGTCATTATGTGG - Intergenic
1027729857 7:81857655-81857677 TTGACCCTAGAGCCTTTAGAGGG + Intergenic
1029309355 7:99647352-99647374 TGAATACTAAAGCCATTAGGTGG - Intergenic
1029312875 7:99683865-99683887 CTTATCCTAAAGTCATTAGGTGG - Intergenic
1029315024 7:99703990-99704012 TTAGCCCTAGAGCCATTAGGTGG - Intronic
1029320705 7:99756878-99756900 TTAGTCCTAAAGCCATTAGGTGG - Intergenic
1032227387 7:130043647-130043669 TCAGTCTTAAAGCCATTAGGCGG + Intronic
1038280609 8:26160939-26160961 TTAGCCCTAAAGCCATTAGGAGG + Intergenic
1038285927 8:26206555-26206577 TTTAACCTAAAGCCATGAGCTGG - Intergenic
1038991976 8:32878059-32878081 TTGAGCCTAAAGAAACTAGGAGG + Intergenic
1041231364 8:55756582-55756604 TCAGTCCTACAGCCATTAGGTGG + Intronic
1042061692 8:64824699-64824721 TCAATTCTAAAGTCATTAGGTGG - Intergenic
1043058948 8:75475646-75475668 CTGATCCATAAGCCATTAGTGGG - Intronic
1044722086 8:95160397-95160419 TCAGCCCTAAAGCCATTAGGTGG - Intergenic
1044791820 8:95855658-95855680 TGGATGTTAAAACCATTAGGTGG + Intergenic
1046960200 8:120103519-120103541 TGGATGCTAAAGTTATTAGGTGG + Intronic
1047239976 8:123078110-123078132 TTAGTCCGAAAGCAATTAGGTGG + Intronic
1052155325 9:25180665-25180687 TTAATCCTGAAGCCATTAGATGG - Intergenic
1055416311 9:76087578-76087600 TTGATCCTATAGTCATTATTAGG + Intronic
1058500537 9:105610816-105610838 TCGATACTAAAACCATTAGATGG - Intronic
1059111201 9:111559782-111559804 TCAATCCTAAAGACATTAGAAGG - Intronic
1186937877 X:14471071-14471093 TTTGTCCTTAAGCCATTTGGGGG - Intergenic
1188300162 X:28497742-28497764 TTGGCCCTAAAGCCAATAAGGGG - Intergenic
1188703009 X:33288560-33288582 TTCATCCTAAGGTCAATAGGAGG - Intronic
1188966714 X:36562602-36562624 TTGATCCAAATGTCATTATGAGG + Intergenic
1189170395 X:38903839-38903861 TTAATCCTAAAGACATTAGGTGG + Intergenic
1191801632 X:65087305-65087327 TCAGTACTAAAGCCATTAGGTGG - Intergenic
1191975377 X:66865386-66865408 CTGTTCCTAAAGCCATTAAGAGG - Intergenic
1195012976 X:100751686-100751708 TTAGTCTGAAAGCCATTAGGTGG + Intergenic
1197160106 X:123313422-123313444 TTGATCCTAATACCATTGGAGGG - Intronic
1198809537 X:140521561-140521583 TTTAACCTAAAGCCAGAAGGGGG + Intergenic
1200009330 X:153109333-153109355 TTGATCCTAAAGGCAGTGGAGGG - Intergenic
1200030270 X:153290589-153290611 TTGATCCTAAAGGCAGTGGAGGG + Intergenic
1201475834 Y:14379750-14379772 TTGGTCCCAGAGTCATTAGGTGG + Intergenic