ID: 1146112036

View in Genome Browser
Species Human (GRCh38)
Location 17:30098510-30098532
Sequence GTAGACAGGGTCTCGTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1588
Summary {0: 1, 1: 1, 2: 15, 3: 265, 4: 1306}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146112036_1146112040 4 Left 1146112036 17:30098510-30098532 CCACAGAACGAGACCCTGTCTAC 0: 1
1: 1
2: 15
3: 265
4: 1306
Right 1146112040 17:30098537-30098559 AAAAAAAAAAAAAAACTCCTGGG 0: 14
1: 258
2: 2415
3: 14733
4: 63771
1146112036_1146112039 3 Left 1146112036 17:30098510-30098532 CCACAGAACGAGACCCTGTCTAC 0: 1
1: 1
2: 15
3: 265
4: 1306
Right 1146112039 17:30098536-30098558 GAAAAAAAAAAAAAAACTCCTGG 0: 3
1: 57
2: 1439
3: 12675
4: 44238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146112036 Original CRISPR GTAGACAGGGTCTCGTTCTG TGG (reversed) Intronic
900223437 1:1521718-1521740 AGAGACAGGGTCTTGCTCTGTGG + Intronic
900286658 1:1904471-1904493 AGAGACAGGGTCTCGCTCTGTGG + Intergenic
900371881 1:2335866-2335888 GTAGACAGAGTCCCGATTTGAGG + Intronic
901009002 1:6188074-6188096 TTAGACAGAATCTCCTTCTGTGG + Intronic
901407819 1:9061584-9061606 TGAGACAGGGTCTCATTTTGTGG - Intronic
901600913 1:10422759-10422781 TGAGACAAGGTCTCATTCTGTGG + Intergenic
901669318 1:10846176-10846198 TGAGACAGGGTCTCACTCTGTGG + Intergenic
901722871 1:11214285-11214307 GTAGAAAGGGGCTCATTTTGTGG - Intronic
901733981 1:11300548-11300570 TGAGACAGGGTCTCACTCTGTGG + Intergenic
901806894 1:11744253-11744275 GGAGACAGGGTCTTGCTCTGTGG - Intronic
901817333 1:11801902-11801924 TGAGACAGAGTCTCATTCTGTGG - Intronic
901892747 1:12281905-12281927 TGAGACAGGGTCTCACTCTGTGG + Intronic
902007104 1:13240925-13240947 GGAGACAGAGTCTCGCTCTGTGG - Intergenic
902026157 1:13385205-13385227 GGAGACAGAGTCTCGCTCTGTGG - Intergenic
902151395 1:14446174-14446196 TGAGACAGGGTCTTGCTCTGTGG - Intergenic
902284321 1:15396788-15396810 TGAGACAGAGTCTTGTTCTGTGG - Intronic
902337173 1:15760198-15760220 TGAGACAGAGTCTCATTCTGTGG - Intronic
902342595 1:15793862-15793884 GGAGAGAGGGTCTCGCTCTGTGG - Intergenic
902363447 1:15955132-15955154 GGAGACAGAGTCTCACTCTGTGG - Intronic
902760654 1:18578763-18578785 GGAGATAGGGTCTCACTCTGCGG - Intergenic
902766561 1:18620255-18620277 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
902937784 1:19777005-19777027 TGAGACAGTGTCTCGTTCTGTGG - Intronic
903091093 1:20918227-20918249 TTAGACAGGGTATCTCTCTGTGG + Intronic
903397404 1:23012321-23012343 TGAGACAGGGTCTCGCTCTGTGG - Intronic
903446478 1:23425463-23425485 TGAGACAGGGTCTCCCTCTGTGG + Intergenic
903562677 1:24240237-24240259 TGAGACAGGGTCTTGCTCTGTGG + Intergenic
903639751 1:24850140-24850162 GGAGACAGAGTCTCACTCTGTGG - Intergenic
903744177 1:25575573-25575595 TAAGACAGGGTCTCATTCTGTGG - Intergenic
903798397 1:25947744-25947766 TGAGACAGGGTCTTGCTCTGTGG - Intergenic
903805186 1:26000142-26000164 GGGGACAGAGTCTCGCTCTGTGG + Intergenic
903837325 1:26213641-26213663 TGAGACAGGGTCTTGCTCTGTGG + Intergenic
903841146 1:26241779-26241801 GGAGACGGAGTCTTGTTCTGTGG + Intronic
903865686 1:26396096-26396118 TTAGACACAGTCTCGCTCTGTGG + Intergenic
903866002 1:26398377-26398399 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
903940967 1:26930994-26931016 TGAGACAGAGTCTCGCTCTGTGG - Intronic
904141602 1:28357756-28357778 GGAGACGGAGTCTCGCTCTGTGG - Intergenic
904225073 1:29010317-29010339 TTAGACAGGGTCTCGCTCTGTGG - Intronic
904574724 1:31497831-31497853 GGGGACAGGGTTTCCTTCTGCGG - Intergenic
904638200 1:31900977-31900999 GGGGACAGGGTTTCTTTCTGTGG - Intergenic
904764124 1:32829480-32829502 AGAGACAGGGTCTCACTCTGTGG + Intronic
905054389 1:35080334-35080356 GGAGACTGGGTCTCGCTCTTTGG + Intronic
905230433 1:36511841-36511863 GGAGACGGGGTCTCCTTATGTGG + Intergenic
905547705 1:38812731-38812753 TGAGACAGAGTCTCGTTCTGTGG + Intergenic
905701740 1:40021468-40021490 TGAGACAGAGTCTCGTTCTTTGG - Intergenic
905872323 1:41412144-41412166 TTAGACAGTGTCTTGCTCTGTGG - Intergenic
906179996 1:43809971-43809993 TGAGACAGGGTCTCACTCTGTGG - Intronic
906229797 1:44152387-44152409 TGAGACAGGGTCTTGCTCTGTGG + Intergenic
906407642 1:45554708-45554730 TTAGACAGGGTTTCAGTCTGTGG + Intronic
907082783 1:51639842-51639864 TGAGATAGGGTCTCGCTCTGTGG + Intronic
907177790 1:52541187-52541209 TAAGACAGAGTCTCGCTCTGTGG - Intronic
907359152 1:53900832-53900854 AGAGACAGGGTCTCATTCTGTGG + Intronic
907432266 1:54419888-54419910 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
907460967 1:54605261-54605283 GGAGAGAGTGTCTCCTTCTGCGG + Intronic
908250890 1:62264849-62264871 TGAGACAGAGTCTCGCTCTGTGG + Intronic
908662233 1:66449352-66449374 GTAGACAGGGTCTATTGCTTAGG + Intergenic
908724737 1:67163447-67163469 TGAGACAGGGTCTTGCTCTGTGG - Intronic
909602019 1:77470898-77470920 TGAGACAGAGTCTCATTCTGTGG + Intronic
909642278 1:77882415-77882437 AGAGACAGGGTCTCATTTTGTGG - Intergenic
909865981 1:80672284-80672306 TTAGACGGAGTCTCGCTCTGTGG + Intergenic
909926878 1:81448162-81448184 TGAGACAGAGTCTCGCTCTGTGG + Intronic
909934281 1:81532902-81532924 TGAGACAGGGTCTCACTCTGTGG - Intronic
909961828 1:81855419-81855441 TGAGACAGGGCCTCGCTCTGTGG - Intronic
909962093 1:81859424-81859446 TGAGACAGGGTCTTGCTCTGTGG + Intronic
910389187 1:86719974-86719996 TGAGACAGAGTCTCGTTCTGTGG - Intronic
910417395 1:87015365-87015387 TGAGACAGAGTCTCGTTCCGTGG + Intronic
910506049 1:87951182-87951204 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
910907948 1:92201431-92201453 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
910942774 1:92554958-92554980 GGAGACAAGGTCTTGCTCTGTGG - Intronic
910976061 1:92907457-92907479 AGAGACAGGGTCTTGCTCTGTGG + Intronic
911436142 1:97860265-97860287 AGAGACAGGGTCTTGTTCTTGGG - Intronic
911622831 1:100086530-100086552 TGAGACAGGTTCTCGTTTTGAGG + Intronic
911633456 1:100208113-100208135 GGAGACAGAGTCTTGCTCTGTGG - Intronic
911702146 1:100966203-100966225 TGAGACAGGGTCTTGCTCTGTGG - Intronic
912338067 1:108881969-108881991 AGAGACAGGGTCTCACTCTGTGG + Intronic
912342220 1:108927941-108927963 AGAGACAGGGTCTCACTCTGTGG - Intronic
912342962 1:108935739-108935761 GGAGACAAGGTCTCACTCTGTGG - Intronic
912352557 1:109028202-109028224 TTAGACAGGGTCTTACTCTGAGG + Intronic
912775332 1:112503090-112503112 GTGGACAAGGTCCCTTTCTGGGG - Intronic
913012763 1:114700992-114701014 AGAGACAGGGTCTCACTCTGTGG + Intergenic
913561339 1:120023415-120023437 TGAGACAGAGTCTCGCTCTGTGG - Intronic
913631956 1:120718912-120718934 AGAGACAGGGTCTCACTCTGTGG + Intergenic
913636788 1:120770187-120770209 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
913957092 1:143316863-143316885 ATAGACAAGGTCCTGTTCTGTGG + Intergenic
913999331 1:143679509-143679531 TGAGACAGAGTCTCGGTCTGTGG + Intergenic
914004656 1:143721812-143721834 GAAGACAGTGTCTGGCTCTGTGG + Intergenic
914051406 1:144142227-144142249 ATAGACAAGGTCCTGTTCTGTGG + Intergenic
914127791 1:144824314-144824336 ATAGACAAGGTCCTGTTCTGTGG - Intergenic
914281923 1:146182824-146182846 TGAGACAGAGTCTCGCTCTGTGG - Intronic
914352358 1:146851669-146851691 TTCGACAGAGTCTCGCTCTGTGG + Intergenic
914542952 1:148633531-148633553 TGAGACAGAGTCTCGCTCTGTGG - Intronic
914623669 1:149437481-149437503 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
914761857 1:150605486-150605508 TGAGACAGGGTCTCACTCTGTGG + Intronic
915113447 1:153579630-153579652 TAAGACAGGGTCTTGCTCTGTGG - Intergenic
915114445 1:153587380-153587402 TGAGACAGGGTCTCGCTCTGTGG - Intergenic
915220768 1:154372734-154372756 TGAGACAGGGTCTCGCTCTGTGG - Intergenic
915329864 1:155104276-155104298 CGAGACAGGGTCTCACTCTGTGG + Intergenic
915336157 1:155143435-155143457 TGAGACAGAGTCTCGTTCTGTGG + Intergenic
915371985 1:155359098-155359120 TAAGACAGGATCTCGTTCTGTGG - Intronic
915385416 1:155487395-155487417 TAAGACAGGGTCTCACTCTGTGG + Intronic
915417665 1:155754547-155754569 TGAGACAGAGTCTCGCTCTGTGG + Intronic
915426291 1:155829968-155829990 CCAGACAGAGTCTCGCTCTGTGG + Intronic
915567238 1:156722278-156722300 TGAGACAGAGTCTCGCTCTGTGG + Exonic
915621499 1:157088337-157088359 GGAGACAGAGTCTTGCTCTGTGG - Intergenic
916582468 1:166121298-166121320 GTAGACAGAGCCTGGTCCTGAGG - Intronic
916659945 1:166914095-166914117 TGAGACAGGGTCTTGCTCTGTGG - Exonic
916771926 1:167917576-167917598 TGAGACAGGGTCTCGCTCTGTGG - Exonic
916936344 1:169632137-169632159 TGAGACAGGGTCTCACTCTGCGG + Intergenic
917056413 1:170986868-170986890 AGAGACAGGGTCTTGCTCTGTGG + Intronic
917074687 1:171192013-171192035 TGAGACAGGGTCTCACTCTGTGG - Intronic
917429251 1:174948488-174948510 TGAGGCAGGGTCTCGCTCTGTGG - Intronic
917477405 1:175380549-175380571 GGAGACAGAGTCTCACTCTGTGG - Intronic
917758645 1:178131224-178131246 ATAGACAGGGTTTCACTCTGTGG + Intronic
918348130 1:183624489-183624511 TGAGACAGAGTCTCGCTCTGTGG - Intronic
918426238 1:184412786-184412808 TGAGGCAGGGTCTCGCTCTGTGG - Intronic
918625917 1:186655807-186655829 TTTGACAGAGTCTCATTCTGTGG - Intergenic
919846147 1:201643451-201643473 TGAGACAGGGTCTCACTCTGTGG + Intronic
920017831 1:202927656-202927678 TTTTACAGGGTCTCATTCTGTGG - Intronic
920320017 1:205113101-205113123 TGAGACAGGGTCTTGCTCTGTGG - Intronic
920639676 1:207740323-207740345 GGAGACAGGGTCTTGCCCTGGGG + Intergenic
920796066 1:209137875-209137897 GGAGACAGAGTCTCACTCTGTGG - Intergenic
921592125 1:217016406-217016428 GGAGGCAGGGTGTTGTTCTGAGG - Intronic
921783590 1:219199456-219199478 GGAGACAGAGTCTCGCTCTGTGG + Intronic
921959313 1:221018013-221018035 GGAGACAGAGTCTCACTCTGTGG + Intergenic
922133337 1:222800716-222800738 TGAGACAGGGTCTCATTTTGTGG - Intergenic
922302364 1:224312799-224312821 TTAGGCAGAGTCTCGTACTGTGG - Intronic
922477415 1:225916211-225916233 TCAGACAGGGTCTCGCTCTGTGG + Intronic
922498032 1:226075777-226075799 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
922804889 1:228380297-228380319 AGAGACAGGGTCTTGCTCTGTGG - Intergenic
922813529 1:228432493-228432515 TTAAACAGGGTCTCACTCTGTGG - Intergenic
922863648 1:228840355-228840377 TCAGACAGAGTCTCGCTCTGTGG - Intergenic
923364299 1:233244689-233244711 TGAGACAGGGTCTTGCTCTGTGG - Intronic
923662768 1:235972764-235972786 TTTGACAGGGTCTTGCTCTGTGG + Intergenic
923775317 1:236972928-236972950 TGAGACGGAGTCTCGTTCTGTGG - Intergenic
923883901 1:238133686-238133708 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
923913672 1:238479132-238479154 TGAGACAGGGTCTGGCTCTGTGG + Intergenic
923938560 1:238793298-238793320 GGAGACAGAGTCTCAGTCTGTGG - Intergenic
923979084 1:239300471-239300493 TCAGACAGGGTCTCACTCTGTGG + Intergenic
924110714 1:240696937-240696959 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
924111150 1:240701223-240701245 GGAGACAGAGTCTTGCTCTGTGG + Intergenic
924231732 1:241967646-241967668 TGAGACAGGGTCTCACTCTGCGG + Intergenic
924481810 1:244441934-244441956 TGAGACAGAGTCTTGTTCTGTGG - Intronic
924527744 1:244867369-244867391 TGAGACAGGGTCTCCCTCTGTGG - Intergenic
924609123 1:245559317-245559339 TGAGACAGGGTCTCACTCTGTGG - Intronic
924630870 1:245739398-245739420 TGAGACAGGGTCTGGCTCTGTGG + Intergenic
924675052 1:246167528-246167550 GAAGACGGAGTCTCGCTCTGTGG + Intronic
924756017 1:246941764-246941786 GGAGACAGAGTCTCTCTCTGTGG + Intergenic
1062905193 10:1175056-1175078 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1062949838 10:1490472-1490494 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1063113837 10:3059223-3059245 AGAGACAGGATCTCGTTATGTGG + Intergenic
1063432668 10:6004850-6004872 TTTGACAGAGTCTCGCTCTGTGG + Intergenic
1063493251 10:6484392-6484414 GAAGACAGAGTCTTGCTCTGTGG - Intronic
1063524012 10:6767446-6767468 AGAGACAGGATCTCGCTCTGTGG + Intergenic
1063593930 10:7415822-7415844 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1063635840 10:7781731-7781753 TTTGACAGGGTCTTGTTTTGTGG - Intronic
1063659567 10:8024904-8024926 TGAGACAGGGTCTTGTTCTGTGG - Intergenic
1063660542 10:8032941-8032963 TGAGACAGGGTCTTGCTCTGTGG - Intergenic
1063969365 10:11370804-11370826 TGAGACAGGGTCTCATTCTGTGG - Intergenic
1064147942 10:12840225-12840247 GTAGTGAGGGACTCTTTCTGTGG + Intergenic
1064205369 10:13319506-13319528 TGAGACAGGGTCTCACTCTGTGG + Intronic
1064211509 10:13364027-13364049 TGAGACCGGGTCTCATTCTGTGG + Intergenic
1064357657 10:14634378-14634400 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1064361511 10:14669348-14669370 TTTGACAGAGTCTCGCTCTGTGG - Intronic
1064411822 10:15111831-15111853 TGAGACAGGGTCTCACTCTGTGG + Intronic
1064749273 10:18509768-18509790 TGAGACAGGGTCTCCCTCTGTGG - Intronic
1064895939 10:20236423-20236445 TTAGACGGAGTCTCGCTCTGTGG - Intronic
1065069545 10:22008317-22008339 CAAGACAGAGTCTCGCTCTGTGG - Intergenic
1065081584 10:22134845-22134867 TGAGGCAGGGTCTCGTTCTGTGG - Intergenic
1065337734 10:24671740-24671762 TGAGACAGGGTCTTGCTCTGTGG + Intronic
1065340902 10:24704308-24704330 TGAGACAGGGTCTCACTCTGTGG + Intronic
1065346593 10:24754111-24754133 TGATACAGGGTCTCATTCTGTGG + Intergenic
1065851398 10:29792830-29792852 TGAGACAGGGTCTTGCTCTGTGG - Intergenic
1066192182 10:33066311-33066333 TGAGACAGGGTCTTGCTCTGTGG + Intergenic
1066331216 10:34425433-34425455 GGAGATAGGGTCTCGCTCTGTGG + Intronic
1066426366 10:35311296-35311318 TGAGACAGGGTCTTGCTCTGTGG - Intronic
1066501452 10:35998829-35998851 CGAGACAGGGTCTCACTCTGTGG - Intergenic
1066641859 10:37561935-37561957 GTGGACAGGGCCTCATTATGTGG - Intergenic
1066760555 10:38743756-38743778 ATAGACAAGGTCCTGTTCTGTGG - Intergenic
1066961036 10:42229011-42229033 ATAGACAAGGTCCTGTTCTGTGG + Intergenic
1067036214 10:42920222-42920244 AGAGACAGGGTCTTGCTCTGTGG - Intergenic
1067377780 10:45743766-45743788 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1067479681 10:46586822-46586844 TTTGACAGAGTCTCGCTCTGTGG - Intronic
1067488406 10:46674272-46674294 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1067532867 10:47087101-47087123 GGAGACAGGGTCTCTCTCTGTGG - Intergenic
1067615056 10:47754975-47754997 TTTGACAGAGTCTCGCTCTGTGG + Intergenic
1067881067 10:50045768-50045790 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
1067885480 10:50084448-50084470 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1068294560 10:55052694-55052716 TGAGACAGGGTCTCACTCTGTGG - Intronic
1068670437 10:59716955-59716977 TGAGACAGGGTCTCACTCTGTGG - Intronic
1069453387 10:68535050-68535072 GGAAACAGGGTCTTGTTCTGTGG + Intergenic
1069473642 10:68714450-68714472 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1069685967 10:70318825-70318847 TGAGACAGGGTCTCACTCTGTGG + Intronic
1069704434 10:70449031-70449053 TGAGACAGGGTCTCAGTCTGTGG - Intergenic
1069829571 10:71274337-71274359 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1069874654 10:71554215-71554237 TGAGACAGGGTCTCACTCTGTGG + Intronic
1069955622 10:72049467-72049489 TGAGACAGGGTCTCATTCTGTGG - Intergenic
1070041853 10:72788605-72788627 TGAGACAGGGTCTCAATCTGTGG - Intronic
1070100778 10:73384419-73384441 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1070122622 10:73593355-73593377 TGAGACAGGGTCTTGCTCTGTGG - Intronic
1070177462 10:73984378-73984400 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
1070287371 10:75093690-75093712 TGAGACAGGGTCTCACTCTGTGG - Intergenic
1070295886 10:75161046-75161068 TGAGACAGGGTCTCACTCTGCGG - Intronic
1070559181 10:77553015-77553037 TGAGACAGGGTCTTGCTCTGGGG - Intronic
1070822378 10:79367432-79367454 TTAGAGAGGGTCTCACTCTGTGG - Intergenic
1070847042 10:79531551-79531573 TGAGACAGGGTCTCACTCTGTGG - Intergenic
1070926754 10:80228726-80228748 TAAGACAGGGTCTCACTCTGTGG + Intergenic
1070944740 10:80380588-80380610 TGAGACAGGGTCTCGCTCTGTGG + Intergenic
1070955345 10:80459912-80459934 GCAGACAGGGTCTTTTTCTGGGG + Intronic
1071592895 10:86892841-86892863 TGAGACAGGGTCTTGCTCTGTGG - Intronic
1071606299 10:86994093-86994115 TGAGACAGGGTCTTATTCTGTGG + Intergenic
1071630457 10:87214935-87214957 TTTGACAGAGTCTCGCTCTGTGG + Intergenic
1072052682 10:91722190-91722212 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
1072109045 10:92300476-92300498 TGAGACAGGGTCTTGCTCTGTGG - Intronic
1072143100 10:92608045-92608067 TGAGACAGAGTCTCGTTCTCAGG - Intronic
1072276105 10:93824955-93824977 TGAGACAGGGTCTCACTCTGTGG - Intergenic
1072596095 10:96873620-96873642 TGAGACAGGGTCTCCCTCTGTGG + Intronic
1072611912 10:97023069-97023091 TGAGACAGGGTCTCACTCTGTGG + Intronic
1072653856 10:97317123-97317145 TGAGACAGGGTCTCATTCTGTGG - Intergenic
1072966796 10:99980782-99980804 TAAGACAGGGTCTCACTCTGTGG - Intronic
1073202437 10:101746564-101746586 TGAGACAGGGTCTTGCTCTGTGG - Intergenic
1073213183 10:101820836-101820858 AGAGGCAGGGTCTTGTTCTGTGG - Intergenic
1073225447 10:101914466-101914488 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1073225833 10:101918066-101918088 TTAGACAGAGTCTTGCTCTGTGG + Intronic
1073295792 10:102437793-102437815 AGAGACAGGGTCTTGCTCTGTGG - Intergenic
1073379515 10:103067116-103067138 TGAGACAGGGTCTCATTCTGTGG + Intronic
1073462201 10:103672263-103672285 TTAGACAGAGTCTCACTCTGTGG - Intronic
1073643922 10:105280003-105280025 TGAGACAGGGTCTCACTCTGTGG - Intergenic
1074244280 10:111672256-111672278 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
1074812776 10:117122363-117122385 GGAGACAGAGTCTCATTTTGTGG + Intronic
1075106863 10:119544949-119544971 GGAGACAGAGTCTTGCTCTGTGG - Intergenic
1075157758 10:119993208-119993230 TGAGACAGGGTCTTGCTCTGTGG + Intergenic
1076009999 10:126980210-126980232 GGAGACAGGGTCTCACTTTGTGG + Intronic
1076253506 10:129001288-129001310 TGAGACAGGGTCTCACTCTGTGG - Intergenic
1077054336 11:583495-583517 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1077263617 11:1637218-1637240 TCAGACAGAGTCTTGTTCTGTGG + Intergenic
1077527217 11:3074425-3074447 TGAGACAGGGTCTGGCTCTGTGG - Intergenic
1077665438 11:4104089-4104111 TGAGACAGGGTCTCATTCTGTGG - Intronic
1078217247 11:9321874-9321896 TGAGGCAGAGTCTCGTTCTGTGG + Intergenic
1078246892 11:9581881-9581903 TGAGACAGTGTCTCATTCTGTGG + Intronic
1078380123 11:10832675-10832697 CAAGACAGGGTCTCACTCTGTGG + Intronic
1079064176 11:17275609-17275631 TGAGACAGGGTCTCACTCTGTGG + Intronic
1079350939 11:19691585-19691607 GGAGACGGAGTCTCGCTCTGTGG + Intronic
1079704436 11:23596652-23596674 TTAGACAGAGTCTCGCTCTGTGG + Intergenic
1079876960 11:25870799-25870821 TGAGACAGGGTCTAGCTCTGTGG - Intergenic
1080069229 11:28059451-28059473 AGAGACAGGGTCTCACTCTGTGG + Intronic
1080072495 11:28106949-28106971 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1080463202 11:32473623-32473645 TGAAACAGGGTCTCGTTCTGTGG + Intergenic
1081665108 11:44912039-44912061 CGAGACAGGGTCTCAGTCTGTGG + Intronic
1081932641 11:46882835-46882857 TGAGACAGGGTCTTGCTCTGTGG - Intronic
1081987057 11:47313324-47313346 GGAGACGGAGTCTCGCTCTGTGG + Intronic
1082056236 11:47819291-47819313 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1082127034 11:48445681-48445703 TGAGACAGGGTCTTGATCTGTGG + Intergenic
1082747092 11:56975882-56975904 TTAGACAGAGTCTCGCTCTGTGG - Intergenic
1083469414 11:62873039-62873061 TCAGACAGGGTCTCGCTCTGTGG + Intronic
1083648810 11:64188405-64188427 AGAGACAGGGTCTGGTTCTGTGG + Intronic
1083684262 11:64367163-64367185 AGAGACAGGATCTTGTTCTGTGG + Intronic
1083788521 11:64968810-64968832 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1083866046 11:65453835-65453857 TTAGACAGAGTCTCACTCTGTGG - Intergenic
1084108110 11:66994077-66994099 TGAGACAGGGTCTCCCTCTGTGG - Intergenic
1084307666 11:68297599-68297621 TGAGACAGGGTCTTGCTCTGTGG - Intergenic
1084309851 11:68310733-68310755 TGAGACAGGGTCTCACTCTGTGG - Intergenic
1084446520 11:69206690-69206712 TGAGACAGGGTCTCGCTCTGTGG + Intergenic
1084532438 11:69735735-69735757 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1084628715 11:70330915-70330937 AGAGACGGGGTCTCGTTCTGTGG - Intronic
1084727404 11:70950625-70950647 TCAGACAGGATCTCGCTCTGTGG + Intronic
1084770657 11:71340996-71341018 TGAGACAGGGTCTCACTCTGTGG + Intergenic
1085171446 11:74453072-74453094 TGAGACAGGGTCTCGCTCTGTGG - Intergenic
1085312969 11:75526763-75526785 TGAGACAGGGTCCCGCTCTGTGG + Intergenic
1085411861 11:76296220-76296242 TGAGACAGGGTCTCACTCTGTGG - Intergenic
1085592220 11:77774549-77774571 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1085592555 11:77777797-77777819 TGAGACAGGGTCTTGTTATGTGG - Intronic
1085633672 11:78141019-78141041 AGAGACAGGGTCTCATTCTGTGG + Intergenic
1087028691 11:93680260-93680282 TGAGACAGGGTCTCGCTCTGTGG - Intronic
1087080783 11:94169196-94169218 GTAGACAGGGGCAAGGTCTGAGG + Intronic
1087635671 11:100698449-100698471 TAAGACAGGGTCTCGCTCTGTGG - Intronic
1088243338 11:107792934-107792956 TAAGACAGGGTCTCGCTCTGTGG + Intronic
1088277488 11:108102825-108102847 GGAGACAGGGTCTCAGGCTGTGG + Intronic
1088452637 11:109998205-109998227 TGAGACAGGGTCTGGCTCTGTGG + Intergenic
1088675690 11:112190262-112190284 AGAGACAGGGTCTTGTTCTGTGG - Intronic
1088866988 11:113857878-113857900 TGAGACAGGGTCTCGCTCTGTGG + Intronic
1088923997 11:114282202-114282224 TGAGACAGGGTCTCACTCTGTGG - Intronic
1089444109 11:118538028-118538050 GGAGACAGGGTCTCACTCTGTGG - Intronic
1089542805 11:119200490-119200512 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
1090021488 11:123132796-123132818 TGAGACAGGGTCTCACTCTGTGG + Intronic
1090364654 11:126195874-126195896 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1090501118 11:127262421-127262443 TGAGACAGGGTCTTGTTCTGTGG + Intergenic
1090671675 11:128951243-128951265 GGAGACAGGGTCTCACTCTGTGG - Intergenic
1090782619 11:130021299-130021321 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1091476221 12:776051-776073 AAAGACAGGATCTCATTCTGTGG + Intronic
1091489192 12:918414-918436 TGAGAGAGGGTCTCGCTCTGTGG + Intronic
1091540599 12:1457871-1457893 TGAGACAGGGTCTCGCTCTGTGG - Intronic
1091561855 12:1620722-1620744 TTAGACGGAGTCTCGCTCTGTGG + Intronic
1091802507 12:3333640-3333662 CTAGAGAGGACCTCGTTCTGGGG + Intergenic
1091900414 12:4140111-4140133 ATAGACAGGGTCTCCCTTTGTGG - Intergenic
1092115645 12:6000790-6000812 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1092477306 12:8830069-8830091 AGAGACAGAGTCTCGCTCTGTGG + Intronic
1092745000 12:11665035-11665057 GAGGACATGGTCTCGCTCTGTGG + Intronic
1092840914 12:12540308-12540330 TAAGACAGGGTCTCACTCTGTGG - Intronic
1092879168 12:12874699-12874721 TGAGTCAGGGTCTCCTTCTGTGG + Intergenic
1092928330 12:13292144-13292166 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
1093225580 12:16479551-16479573 TGAGACAGGGTCTTGCTCTGTGG + Intronic
1093264777 12:16989827-16989849 TTAGACAGAGTCTCACTCTGTGG - Intergenic
1093613583 12:21193808-21193830 GGAGACAGAGTCTCACTCTGTGG + Intronic
1093855466 12:24096416-24096438 GTTTACAGGGTTTCCTTCTGGGG - Intergenic
1093883129 12:24428584-24428606 GGAGACAGGGTCTCACTCTGTGG - Intergenic
1093961098 12:25273687-25273709 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
1094364998 12:29670913-29670935 TGAGACAGAGTCTCGTGCTGTGG - Intronic
1094619296 12:32064855-32064877 TCAGACAGGGTCTCGCTCTGTGG - Intergenic
1094620965 12:32079837-32079859 AGAGACAGGGTCTTGCTCTGCGG + Intergenic
1094631054 12:32174481-32174503 GGAGACAGGGTCTTGCTCTGTGG - Intronic
1094693127 12:32789020-32789042 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1096061922 12:48708525-48708547 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1096197746 12:49659428-49659450 AGAGACAGGGTCTCACTCTGTGG + Intronic
1096202359 12:49693956-49693978 AAAGACAGGGTCTCATTCAGAGG + Intronic
1096319555 12:50599270-50599292 TGAGACAGGGTCTCACTCTGTGG - Intronic
1096320939 12:50612225-50612247 CGAGACAGGGTCTCACTCTGTGG - Intronic
1097060162 12:56277182-56277204 TTAGACAGAGTCTCGCTCTGTGG - Intronic
1097101518 12:56593158-56593180 TGAGACAGGGTCTCACTCTGTGG + Exonic
1097163557 12:57068369-57068391 TTAAACAGGGTCTCCCTCTGTGG + Intronic
1097207141 12:57332062-57332084 CAAGACAGGGTCTTGCTCTGTGG - Intronic
1097212335 12:57381835-57381857 ACACACAGGGTCTCGCTCTGAGG + Intronic
1097248897 12:57621605-57621627 GTAGAGAGGGCCTCGCTCTGGGG + Intronic
1097642743 12:62202364-62202386 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1097803346 12:63939139-63939161 CTAGACAAGGTCTTGCTCTGTGG - Intronic
1098004233 12:65978610-65978632 TGAGACAGGGTCTCTCTCTGTGG + Intergenic
1098329601 12:69339520-69339542 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
1098787381 12:74776627-74776649 TGAGACAGGGTCTCGCTCTGTGG - Intergenic
1099296656 12:80836633-80836655 TGAGACAGGGTCTCATTCTGTGG - Intronic
1099698720 12:86057195-86057217 AGAGACAGGGTCTAGCTCTGTGG + Intronic
1099925691 12:89013850-89013872 GAAGACAGGGTCAAGTTCAGAGG - Intergenic
1100171193 12:91976827-91976849 TGAGACAGAGTCTCATTCTGTGG - Intergenic
1100551820 12:95653170-95653192 TAAGACAGGGTCTCACTCTGTGG + Intergenic
1100589860 12:96016579-96016601 GGAGACAAGGTCTCACTCTGTGG - Intronic
1100602316 12:96122523-96122545 AGAGACAGGGTCTCGTTCTGTGG + Intergenic
1101106687 12:101447217-101447239 AAAGACAGGGTCTCGCTCTGTGG - Intergenic
1101403780 12:104410839-104410861 TGAGACAGGGTCTCACTCTGTGG - Intergenic
1101463894 12:104927036-104927058 TGAGACAGGGTCTCGCTCTGTGG - Intronic
1101508639 12:105372735-105372757 AGAGACAGGGTCTTGTTCTGTGG - Intronic
1101680651 12:106961072-106961094 TGAGACAGGGTCTCGCTCTATGG + Intronic
1101793512 12:107952101-107952123 TGAGACAGGGTCTCGCTCTGTGG - Intergenic
1102334627 12:112067663-112067685 TGAGACAGGGTCTCGCTCTGTGG - Intronic
1102335698 12:112077450-112077472 GGAGACAGAGTCTCACTCTGTGG - Intronic
1102910695 12:116711632-116711654 TCAGACAGGGTCTCACTCTGTGG + Exonic
1102915555 12:116749672-116749694 TTAAACAGGGTCACATTCTGAGG + Intronic
1102995434 12:117346449-117346471 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1103294543 12:119875281-119875303 CAAGACAGGGTCTTGCTCTGTGG - Intronic
1103495116 12:121355964-121355986 GGAGCCAGGGTCTCACTCTGTGG + Intronic
1103514942 12:121501361-121501383 GAAGACAGAGTCTTGCTCTGTGG - Intronic
1103639490 12:122337993-122338015 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1103753225 12:123181863-123181885 TGAGACAGGGTCTCGCTCTGTGG - Intronic
1103797674 12:123516012-123516034 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1103805689 12:123570982-123571004 TGAGACAGGGTCTCATTCTGTGG + Intergenic
1103814065 12:123638813-123638835 TGAGACAGAGTCTTGTTCTGTGG + Intronic
1103943189 12:124511939-124511961 TTTGACAGGGTCTCACTCTGTGG + Intronic
1103971958 12:124678107-124678129 AGAGACAGGGTCTCACTCTGTGG + Intergenic
1104054473 12:125218905-125218927 GGATACAGGGTCTCCTTTTGGGG + Intronic
1104092827 12:125530007-125530029 ACAGACAGGGTCTCGCTCTGCGG - Intronic
1104191499 12:126485934-126485956 TGAGACAGAGTCTCTTTCTGTGG - Intergenic
1104551700 12:129763095-129763117 TGAGACAGGGTCTCACTCTGTGG + Intronic
1104595561 12:130117983-130118005 AGAGGCAGGGTCTCGCTCTGTGG + Intergenic
1105071564 12:133236724-133236746 AGAGGCAGGGTCTCGCTCTGTGG + Intergenic
1105204951 13:18213783-18213805 GCAGACAGAGTCTTGTTCTGTGG - Intergenic
1105302105 13:19144644-19144666 GGAGACAGGGTCTCACTGTGTGG - Intergenic
1105402336 13:20106408-20106430 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1105556339 13:21449662-21449684 GGAGACAGAGTCTCACTCTGTGG + Intronic
1105754486 13:23452221-23452243 GGAGACAGGGTCTTGCTCTGTGG + Intergenic
1105809063 13:23978723-23978745 TGAGACAGGGTCTCATTTTGTGG + Intergenic
1105861979 13:24423850-24423872 GGAGACAGGGTCTTGCTATGTGG + Intronic
1106012086 13:25834692-25834714 GGAGACAGGGTCTCACTCTGTGG + Intronic
1106255007 13:28014249-28014271 TGAGACAGGGTCTCGCTCTGTGG - Intronic
1106267150 13:28120709-28120731 TGAGACAGGGTCTCACTCTGTGG + Intergenic
1106291807 13:28370162-28370184 TGAGACAGGGTCTTGCTCTGTGG - Intronic
1106655258 13:31736644-31736666 TTAGACAGGGTCTTGTGCAGTGG - Intergenic
1107366690 13:39686747-39686769 TGAGACAGGGTCTTGCTCTGTGG + Intronic
1107616608 13:42174719-42174741 TGAGACAGGGTCTTGCTCTGTGG + Intronic
1107617128 13:42181255-42181277 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1107646907 13:42503690-42503712 TGAGACAGGGTCTCACTCTGTGG - Intergenic
1107839652 13:44442895-44442917 TTTGACAGAGTCTCGCTCTGTGG - Intronic
1107858820 13:44641816-44641838 GGAGACAGGGTCTCATTCTATGG + Intergenic
1107868824 13:44728796-44728818 TGAGACAGGGTCTTGCTCTGTGG + Intergenic
1107897844 13:44983775-44983797 TGAGACAGGGTCTTGTTCTGTGG - Intronic
1107905976 13:45061625-45061647 GGAGACAGGCTCTTGCTCTGTGG - Intergenic
1108205114 13:48080375-48080397 TGAGACAGGGTCTTGCTCTGTGG - Intronic
1108362462 13:49679688-49679710 AGAGACGGGGTCTCGTTATGTGG + Intronic
1108634471 13:52318774-52318796 TGAGACAGAGTCTCGCTCTGGGG + Intergenic
1109171701 13:59105905-59105927 TGAGACAGGGTCTCACTCTGTGG + Intergenic
1109469584 13:62788152-62788174 ACAAACAGGGTCTCATTCTGAGG - Intergenic
1109713772 13:66194048-66194070 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
1109722313 13:66290537-66290559 TGAGACAGGGTCTTGCTCTGTGG - Intergenic
1109855871 13:68127569-68127591 GTAGACAGAGTCTTCCTCTGTGG - Intergenic
1110772450 13:79365421-79365443 GGAGACAGAGTCTCACTCTGTGG - Intronic
1111280797 13:86021402-86021424 ATAGACAGGGTCTCACTGTGTGG - Intergenic
1111295297 13:86269378-86269400 AGAGACAGGGTCTCGCTATGTGG + Intergenic
1111534344 13:89582534-89582556 TGAGACTGTGTCTCGTTCTGTGG - Intergenic
1112309908 13:98309184-98309206 GGAGACGGAGTCTCGCTCTGTGG + Intronic
1112565230 13:100546649-100546671 AGAGACAGGGTCTCACTCTGAGG - Intronic
1112628464 13:101134148-101134170 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1112662755 13:101531750-101531772 TTAGACGGAGTCTCGCTCTGTGG + Intronic
1112878053 13:104069893-104069915 AGAGACAGGGTCTTGTTCTGTGG + Intergenic
1112960882 13:105124405-105124427 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1113245746 13:108392836-108392858 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1113634805 13:111912271-111912293 TTAGACAGGGTCTCACTCTGTGG + Intergenic
1113718099 13:112528869-112528891 TGAGACAGGGTCTCACTCTGTGG + Intronic
1113736384 13:112681360-112681382 TGAGACAGGGTCTTGCTCTGTGG + Intronic
1113835645 13:113326649-113326671 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1114445658 14:22786000-22786022 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1114448572 14:22809197-22809219 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1114513078 14:23278547-23278569 GTAGACAGGGTCTCACTATGTGG + Intronic
1115211268 14:30969415-30969437 GGAGACAGAGTCTCGCTCTGTGG - Intronic
1115266336 14:31504587-31504609 TGAGACAGGGTTTTGTTCTGTGG + Intronic
1115586067 14:34814486-34814508 GGAGACAGGGTCTCACTCGGTGG + Intronic
1115594685 14:34897970-34897992 TTAGACAGGGTCTTGCTCTGTGG + Intergenic
1115612710 14:35064026-35064048 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1115758345 14:36552428-36552450 TGAGACAGGGTCTCACTCTGTGG + Intergenic
1116235899 14:42279309-42279331 GGAGACAGAGTCTCGCTCTGTGG + Intergenic
1116668301 14:47807103-47807125 TGAGACAGAGTCTAGTTCTGTGG - Intergenic
1116812918 14:49556487-49556509 TAAGACAGGGTCTCACTCTGTGG - Intergenic
1116839166 14:49801969-49801991 TGAGACAGGGTCTCATTCTGTGG + Intronic
1116840765 14:49819088-49819110 GGAGACAGAGTTTCGCTCTGTGG - Intronic
1116879490 14:50150579-50150601 TGAGACAGGGTCTTGCTCTGTGG + Intronic
1117111314 14:52458525-52458547 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1117141338 14:52793284-52793306 TGAGACAGGGTCTTGCTCTGTGG - Intergenic
1117788251 14:59310128-59310150 TGAGACAGGGTCTTGCTCTGTGG + Intronic
1118099927 14:62586545-62586567 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
1118121272 14:62846818-62846840 GGAGACAGAGTCTGGCTCTGCGG + Intronic
1118194746 14:63614325-63614347 TGAGACAGGGTCTCACTCTGTGG + Intronic
1118396036 14:65337467-65337489 TGAGACAGGGTCTCACTCTGTGG - Intergenic
1119073708 14:71614196-71614218 GGAGACAGCGTCTTGCTCTGTGG - Intronic
1119110028 14:71963468-71963490 GGATACAGGGTCTCCTTCAGGGG - Intronic
1119312537 14:73661142-73661164 TTAGACAGAGTCTCGCTCTGTGG - Intronic
1119610201 14:76055324-76055346 AGAGACAGGGTCTCACTCTGTGG - Intronic
1119752202 14:77087437-77087459 TGAGACAGGGTCTCACTCTGTGG - Intergenic
1120318522 14:82928829-82928851 TGAGACAGAGTCTCGTTCTGTGG - Intergenic
1120598035 14:86465318-86465340 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1121293704 14:92798894-92798916 GGAGACAGCGTCTCATTCTACGG - Intronic
1121542133 14:94736211-94736233 TGAGACAGGTTCTTGTTCTGTGG + Intergenic
1121581072 14:95031331-95031353 GTAGAGAGGGTTTCTTTCTTTGG - Intergenic
1121827597 14:97023101-97023123 GTAAAAAGGGTCACATTCTGAGG + Intergenic
1121975913 14:98403998-98404020 TGAGACATGGTCTCATTCTGTGG - Intergenic
1122137318 14:99641957-99641979 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
1122260187 14:100513953-100513975 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1122491701 14:102121050-102121072 TGAGACAGGGTCTTGCTCTGTGG + Intronic
1122511470 14:102271896-102271918 TGAGACAGGGTCTCACTCTGTGG + Intronic
1122646886 14:103200685-103200707 GGAGACAGGGTGTCTCTCTGTGG + Intergenic
1122980415 14:105189533-105189555 AGAGACAAGGTCTCGTTCTGTGG - Intergenic
1202931263 14_KI270725v1_random:33185-33207 ATAGACAAGGTCCTGTTCTGTGG - Intergenic
1123421157 15:20138485-20138507 ATAGACAAGGTCCTGTTCTGTGG + Intergenic
1123443972 15:20308294-20308316 ATAGACAAGGTCCTGTTCTGTGG - Intergenic
1123530382 15:21145021-21145043 ATAGACAAGGTCCTGTTCTGTGG + Intergenic
1123757836 15:23410750-23410772 GGATGCAGGGTCTCATTCTGTGG - Intergenic
1124021266 15:25926110-25926132 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1124059528 15:26276740-26276762 TAAGACAGGGTCTCACTCTGTGG - Intergenic
1124398248 15:29324118-29324140 TAATACAGGGTCTCATTCTGTGG + Intronic
1124544941 15:30618196-30618218 TTAGACAGAGTCTTGCTCTGTGG + Intergenic
1124781023 15:32633621-32633643 TGAGACAGGGTCTCACTCTGCGG - Intronic
1124844990 15:33281509-33281531 TGAGACAGGGTCTCGCTCTGTGG + Intergenic
1125136451 15:36349624-36349646 CTAGACGGAGTCTCGCTCTGTGG + Intergenic
1125581440 15:40788674-40788696 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1125594754 15:40877509-40877531 TTTGCCAGGGTCTCGCTCTGTGG + Intergenic
1125660030 15:41386696-41386718 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
1125917386 15:43501219-43501241 AGAGACAGGGTCTTGCTCTGTGG + Intronic
1125970080 15:43904386-43904408 TGAGACAGGGTCTCGCTCTGTGG + Intronic
1126116422 15:45211824-45211846 AGAGACAGGGTGTCGCTCTGAGG + Intergenic
1126622394 15:50653122-50653144 GGAAACAGGGTCTCACTCTGTGG - Intronic
1126641063 15:50827581-50827603 TGAGACAGGGTCTCGTTCTGTGG + Intergenic
1126751342 15:51880452-51880474 GTGCACAGGGTTTCTTTCTGGGG - Intronic
1127059594 15:55168708-55168730 TGGGACAGGGTCTCGCTCTGTGG + Intergenic
1127250617 15:57233361-57233383 TGAGACAGGGTCTCATTATGTGG + Intronic
1127272394 15:57413290-57413312 TGAGACAGGGTCTTGCTCTGTGG + Intronic
1127409293 15:58689464-58689486 GGAGACAGAGTCTTGCTCTGTGG - Intronic
1127699651 15:61485940-61485962 GGAGACAGAGTCTCACTCTGTGG + Intergenic
1127933311 15:63612166-63612188 TGAGACAGGGTCTCACTCTGTGG - Intronic
1128037013 15:64536061-64536083 AGAGACAGGGTCTCACTCTGTGG + Intronic
1128040301 15:64566308-64566330 AGAGACAAGGTCTCGATCTGTGG - Intronic
1128056068 15:64701082-64701104 TGAGACAGGGTCTCACTCTGTGG - Intronic
1128057638 15:64712407-64712429 TGAGACAGGGTCTCACTCTGTGG + Intergenic
1128203524 15:65830378-65830400 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1128419524 15:67478363-67478385 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1128464157 15:67894796-67894818 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1128471221 15:67955274-67955296 AGAGACAAGGTCTCGCTCTGTGG - Intergenic
1128647892 15:69390367-69390389 TGAGACAGGGTCTCTCTCTGTGG + Intronic
1128898299 15:71395720-71395742 GGGGACAGGGGCTTGTTCTGTGG - Intronic
1128993193 15:72277612-72277634 GTAGACAGGGTCTCAATATGTGG + Intronic
1129142442 15:73612398-73612420 GGAGACAGGATCTCGCTCTGTGG - Intronic
1130046938 15:80452955-80452977 AGAGACAGGGTCTCGCTCTGTGG + Intronic
1130601129 15:85274457-85274479 TGAGACAGCGTCTCGCTCTGTGG + Intergenic
1130664721 15:85860173-85860195 TGAGACAGGGTCTCACTCTGTGG + Intergenic
1131237068 15:90705986-90706008 TGAGACAGGGTCTTGCTCTGTGG + Intergenic
1131376528 15:91928713-91928735 GTATTCAGGGCCTAGTTCTGTGG + Intronic
1131397523 15:92098261-92098283 GTAGACATGGGCCAGTTCTGGGG + Intronic
1131405298 15:92159462-92159484 TGAGACAGAGTTTCGTTCTGTGG - Intronic
1131727044 15:95238148-95238170 TGAGACAGGGTCTTGCTCTGTGG + Intergenic
1131816043 15:96222325-96222347 TGAGACAGGGTCTGGCTCTGTGG + Intergenic
1131884676 15:96899114-96899136 GTGGCCAGGATCCCGTTCTGTGG + Intergenic
1132029182 15:98426748-98426770 TGAGACAGGGTCTCGCTCTGTGG + Intergenic
1132099116 15:99010465-99010487 TGAGACAGGGTCTCACTCTGTGG + Intergenic
1132417853 15:101636861-101636883 AGAGACAGTGTCTCGCTCTGTGG + Intronic
1132493136 16:245323-245345 TGAGACAGGGTCTCACTCTGTGG - Intronic
1132528698 16:432617-432639 TGTGACAGGGTCTCGCTCTGTGG + Intronic
1132613651 16:829836-829858 GGAGACAGGGTTTCCTTTTGGGG - Intergenic
1132639953 16:973323-973345 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1132673287 16:1111014-1111036 TGAGACAGGGTCTCACTCTGTGG + Intergenic
1132674479 16:1116037-1116059 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1132772330 16:1570773-1570795 TGAGACAGGGTCTCACTCTGTGG + Intronic
1132792780 16:1702024-1702046 TTACACAGGGTCTTGCTCTGTGG - Exonic
1132917299 16:2357401-2357423 TGAGACAGGGTCTGGCTCTGTGG - Intergenic
1133003593 16:2864730-2864752 TTAGACGGGGTCTCACTCTGTGG - Intergenic
1133038768 16:3048823-3048845 TTAGACAGAGTCTCACTCTGTGG + Intronic
1133153156 16:3852182-3852204 TGAGACAGAGTCTCGCTCTGCGG + Intronic
1133214663 16:4284451-4284473 GGAGACAGGGTCTCACTCTGCGG - Intergenic
1133252548 16:4493044-4493066 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1133300728 16:4780957-4780979 AGAGACAGGGTCTTGTTCTGTGG - Intronic
1133475724 16:6119897-6119919 GGATACAGGGTCTCCTTCTAGGG - Intronic
1133773538 16:8881555-8881577 TGAGACAGGGTCTTGCTCTGTGG - Intergenic
1133806816 16:9131939-9131961 GGAGACAGAGTCTCACTCTGTGG - Intergenic
1133906834 16:10029975-10029997 GGAGACAGAGTCTCACTCTGTGG - Intronic
1133950844 16:10391135-10391157 TGAGACAGGGTCTCTCTCTGTGG - Intronic
1134119650 16:11574820-11574842 TGAGACAGAGTCTCATTCTGTGG + Intronic
1134260998 16:12650765-12650787 AGAGACAGGGTCTTGCTCTGTGG - Intergenic
1134410329 16:13998624-13998646 CGAGACAGGGTCTTATTCTGTGG - Intergenic
1134452825 16:14373839-14373861 AGAAACAGGGTCTCGCTCTGTGG + Intergenic
1134458497 16:14412006-14412028 GGAGGCAGGGTCTCATTCTGTGG + Intergenic
1134467913 16:14495454-14495476 GGAGACAGAGTCTTGTTCTGTGG - Intronic
1134510863 16:14845845-14845867 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1134602446 16:15543799-15543821 AGAGACAGGGTCTTGCTCTGTGG - Intronic
1134629374 16:15745934-15745956 AGAGACAGGGTCTGGCTCTGCGG + Intronic
1134642543 16:15840710-15840732 TGAGACAGGGTCTCGCTCTGTGG - Intronic
1134652988 16:15925536-15925558 TGAGACAGGGTCTTGCTCTGCGG - Intergenic
1134656715 16:15953021-15953043 TGAGACAGGGTCTCAGTCTGTGG - Intronic
1134698505 16:16244332-16244354 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1134973330 16:18550346-18550368 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1135019006 16:18947975-18947997 TGAGACAAGGTCTCATTCTGTGG + Intergenic
1135123452 16:19786356-19786378 AGAGACAGGGTCTCGCTATGTGG - Intronic
1135133452 16:19871096-19871118 AGAGACAGGGTCTCATTATGTGG - Intronic
1135139606 16:19910253-19910275 GGAGACAGTGTCTCCCTCTGTGG + Intergenic
1135160832 16:20094565-20094587 AGAGACTGGGTCTCGTTCTCGGG + Intergenic
1135239005 16:20786661-20786683 AGAGACAGGGTCTTGCTCTGTGG - Intronic
1135309924 16:21397485-21397507 TGAGACAGGGTCTCCCTCTGTGG - Intergenic
1135350967 16:21728607-21728629 TTAGACGGAGTCTCGCTCTGTGG + Intronic
1135356659 16:21774531-21774553 TGAGACAGGGTCTTGCTCTGTGG + Intergenic
1135362818 16:21829586-21829608 TGAGACAGGGTCTCCCTCTGTGG - Intergenic
1135455159 16:22590672-22590694 TGAGACAGGGTCTTGCTCTGTGG + Intergenic
1135459808 16:22632159-22632181 GGAGACAGAGTCTTGCTCTGTGG + Intergenic
1135576370 16:23588953-23588975 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1135604283 16:23809700-23809722 CAAGACAGGGTCTCACTCTGTGG + Intergenic
1135628599 16:24017916-24017938 TTAGACAGAGTCTCGCTCTGTGG + Intronic
1135645553 16:24158676-24158698 AGAGACAGGGTCTTGCTCTGTGG + Intronic
1135667271 16:24346556-24346578 AGAGACAGGGTCTCATTCTGTGG - Intronic
1135702984 16:24649326-24649348 TGAGACAGGGTCTCACTCTGTGG + Intergenic
1135741043 16:24975486-24975508 GTAGGCTGGGTCTGGTTCCGAGG + Intronic
1135770654 16:25215895-25215917 TTAGACAGGGTCTCACTCTGAGG + Intronic
1135968392 16:27054126-27054148 TGAGACAGGGTCTTGCTCTGTGG - Intergenic
1136005548 16:27326638-27326660 AGAGACAGGGTCTCATTCTGTGG - Intronic
1136042304 16:27589810-27589832 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1136065726 16:27757102-27757124 TGAGACAGGGTCTCACTCTGTGG + Intronic
1136149505 16:28337812-28337834 TGAGACAGGGTCTCCCTCTGTGG - Intergenic
1136176387 16:28519887-28519909 GGAGACAGAGTCTCGATCTGTGG - Intergenic
1136176712 16:28522137-28522159 AGAGACAGGGTCTTGCTCTGTGG + Intergenic
1136234856 16:28907178-28907200 TGAGACAGGGTCTCACTCTGTGG + Intronic
1136249229 16:28992966-28992988 TGAGACAGAGTCTCATTCTGTGG + Intergenic
1136249716 16:28996421-28996443 TGAGACAGGGTCTCATTCTGTGG + Intergenic
1136252344 16:29013848-29013870 TTAGACAGTGTCTTGCTCTGTGG - Intergenic
1136274036 16:29167574-29167596 TTAGACAGAGTCTCGCTCTGTGG - Intergenic
1136306669 16:29376609-29376631 TGAGACAGGGTCTCCCTCTGTGG - Intergenic
1136376318 16:29867435-29867457 GGAGACAGAGTCTCGATCTGTGG - Intergenic
1136486108 16:30572601-30572623 TGAGACAGGGTCTTGCTCTGTGG + Exonic
1136488651 16:30590118-30590140 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1136508139 16:30719531-30719553 TGAGGCAGGGTCTTGTTCTGTGG + Intronic
1136587677 16:31198045-31198067 TGAGACAGGGTCTTGCTCTGTGG + Intergenic
1136706239 16:32190115-32190137 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1136722232 16:32335550-32335572 GTAGACAAGGTCCTGTTCTGTGG + Intergenic
1136761671 16:32739290-32739312 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
1136806429 16:33131099-33131121 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1136840549 16:33541529-33541551 GTAGACAAGGTCCTGTTCTGTGG + Intergenic
1137063195 16:35810888-35810910 GCAGCCAGGGCCTCGTTTTGAGG - Intergenic
1137350286 16:47707669-47707691 TGAGACAGGGTCTCACTCTGTGG - Intergenic
1137624357 16:49898317-49898339 AGAGACAGGGTCTCACTCTGAGG + Intergenic
1138017202 16:53439932-53439954 GGAGACAAGGTCTTGCTCTGTGG - Intronic
1138569964 16:57864218-57864240 TGAGACAGGGTCTTGCTCTGTGG + Intergenic
1138635089 16:58331911-58331933 GTACACAGGGTCTTATTTTGGGG - Intronic
1138635528 16:58334928-58334950 TGAGACAGGGTCTTGCTCTGTGG - Intronic
1139445703 16:66997043-66997065 TGAGACAGGGTCTCACTCTGTGG - Intronic
1139682356 16:68574905-68574927 TGAGACAGGGTCTCACTCTGTGG - Intronic
1139712324 16:68785491-68785513 CAAGACAGAGTCTTGTTCTGTGG + Intronic
1139941816 16:70610991-70611013 TGAGACAGGGTCTTGCTCTGTGG + Intronic
1139981671 16:70863850-70863872 TTCGACAGAGTCTCGCTCTGTGG - Intronic
1140500717 16:75431617-75431639 CGAGACAGTGTCTCGCTCTGTGG - Intronic
1140760493 16:78104482-78104504 TTAGACAAGGTCTCATTCTGTGG - Intronic
1141005741 16:80349943-80349965 GAAGAAAGGTTCTTGTTCTGAGG - Intergenic
1141012113 16:80412515-80412537 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
1141237001 16:82228200-82228222 TAAGACAGGGTCTTGCTCTGTGG + Intergenic
1141463627 16:84192862-84192884 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1141714345 16:85718112-85718134 TGAGACAGGGTCTCTCTCTGTGG + Intronic
1141924859 16:87161329-87161351 GAAGACAGGGTTTCTTTTTGAGG + Intronic
1142046816 16:87930758-87930780 TGAGACAGAGTCTCCTTCTGTGG + Intronic
1142077686 16:88129839-88129861 TTAGACAGAGTCTCGCTCTGTGG - Intergenic
1142179735 16:88662570-88662592 GGACACAGGGTCTCGGGCTGGGG + Intronic
1142339682 16:89513217-89513239 TGAGACAGGGTCTCGCTATGTGG - Intronic
1142387477 16:89775068-89775090 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1203004199 16_KI270728v1_random:182214-182236 GTAGACAAGGTCCTGTTCTGTGG - Intergenic
1203063828 16_KI270728v1_random:999604-999626 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
1203135807 16_KI270728v1_random:1718621-1718643 GTAGACAAGGTCCTGTTCTGTGG - Intergenic
1203150716 16_KI270728v1_random:1841826-1841848 GTAGACAAGGTCCTGTTCTGTGG + Intergenic
1142539996 17:651402-651424 AGAGACAGGGTCTCACTCTGTGG - Intronic
1142681302 17:1550545-1550567 TGAGACAGGGTCTCACTCTGTGG + Intronic
1142693371 17:1620346-1620368 GGAGACAGAGTCTCACTCTGTGG - Intronic
1143224864 17:5292700-5292722 TGAGACAGGGTCTTGCTCTGTGG + Intronic
1143251892 17:5529385-5529407 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1143372367 17:6448261-6448283 TGAGACAGGGTCTGGCTCTGTGG - Intronic
1143560897 17:7694261-7694283 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1143570758 17:7756698-7756720 AGAGACAGGGTCTTGCTCTGTGG + Intronic
1143605198 17:7980244-7980266 TGAGACAGGGTCTCGCTCTGTGG + Intergenic
1143653182 17:8277055-8277077 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1143769613 17:9160129-9160151 TGAGATAGGGTCTCGCTCTGTGG + Intronic
1144192975 17:12862960-12862982 ATAGACAGGGTCTCACTCTGTGG - Intronic
1144355695 17:14444059-14444081 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1144466942 17:15504580-15504602 AGAGACAGGGTCTCGTGCTTTGG + Intronic
1144503230 17:15807532-15807554 CGAGACAGAGTCTCGCTCTGTGG + Intergenic
1144569240 17:16385526-16385548 AGAGACAGGGTCTCACTCTGTGG + Intergenic
1144871541 17:18374992-18375014 GGAGACAGAGTCTCGCTCTGTGG - Intergenic
1144932105 17:18868094-18868116 TGAGACAGGGTCTCACTCTGTGG - Intronic
1145362915 17:22227157-22227179 CTAGACAGAGTCTCGCTCTGTGG + Intergenic
1145943925 17:28759222-28759244 GTAGACACGGTCACATTCGGGGG + Exonic
1146112036 17:30098510-30098532 GTAGACAGGGTCTCGTTCTGTGG - Intronic
1146207039 17:30913769-30913791 TTAGACAAAGTCTCGCTCTGGGG - Intronic
1146252124 17:31355828-31355850 TTTGATAGGGTCTCGCTCTGTGG - Intronic
1146319466 17:31835417-31835439 TGAGACAGAGTCTTGTTCTGTGG + Intergenic
1146834073 17:36095714-36095736 CAAGACAAGGTCTCATTCTGTGG + Intergenic
1147363560 17:39945971-39945993 TTAGAGAAGGTCTCGATCTGTGG - Intergenic
1147447440 17:40483224-40483246 TTAGACAGGGTCTCATTCTTTGG + Intronic
1147484362 17:40797726-40797748 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1147624999 17:41894355-41894377 TGAGACAGGGTCTCACTCTGTGG - Intronic
1147681815 17:42253693-42253715 AGAGACAGGGTCTTGTTCTGTGG + Intronic
1147695438 17:42348907-42348929 GAAGACAGAGTCTTGCTCTGTGG + Intronic
1147697798 17:42369668-42369690 AGAGACAGGGTCTCACTCTGTGG + Intronic
1147761627 17:42801163-42801185 GGAGACAGAGTCTTGCTCTGTGG - Intronic
1147962436 17:44176335-44176357 GGAGACAGGGTCTCTCTCTGTGG - Intronic
1148130689 17:45261112-45261134 TTTGACAGGGTCTTGCTCTGTGG + Intronic
1148182449 17:45616456-45616478 TCAGACAGGGTCTTATTCTGCGG + Intergenic
1148266406 17:46229241-46229263 TCAGACAGGGTCTTATTCTGCGG - Intergenic
1148281427 17:46350826-46350848 GGAGACAGGGTCTCGTGCAGTGG - Intronic
1148303652 17:46568763-46568785 GGAGACAGGGTCTCGTGCAGTGG - Intronic
1148509772 17:48158546-48158568 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1148517835 17:48238418-48238440 TGAGACAGGGTCTCATTCTGTGG + Intronic
1148531215 17:48394201-48394223 TTAGACAGAGTCTCACTCTGTGG - Intronic
1148569995 17:48660571-48660593 CGAGACAGGGTCTCACTCTGTGG - Intergenic
1148634189 17:49134605-49134627 TTAGACAGAGTCTAGCTCTGTGG + Intronic
1148661903 17:49340877-49340899 GGAGACAGGGTCTCACTCTGTGG - Intronic
1148801561 17:50229989-50230011 AGAGACAGGGTCTTGCTCTGTGG + Intergenic
1148802918 17:50243952-50243974 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
1148890408 17:50803030-50803052 TGAGACAGGGTCTTGCTCTGTGG + Intergenic
1149711768 17:58749754-58749776 TGAGACAGGGTCTTGCTCTGTGG + Intergenic
1149759678 17:59218179-59218201 TTAGACAGAGTCTCACTCTGTGG - Intergenic
1149799255 17:59551591-59551613 TTAGACGGAGTCTCGCTCTGTGG - Intergenic
1149862071 17:60127524-60127546 GTATAAAGGGTCTGGTTCAGGGG + Intergenic
1150298266 17:64026872-64026894 TTAGACGGAGTCCCGTTCTGTGG - Intergenic
1150344936 17:64397447-64397469 TGAGACAGGGTCTTGCTCTGTGG + Intronic
1150345952 17:64404872-64404894 TTTGACAGAGTCTCGCTCTGTGG - Intronic
1150365347 17:64577963-64577985 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1150438443 17:65172233-65172255 TGAGACAGAGTCTCGCTCTGGGG + Intronic
1150527785 17:65941801-65941823 GGAGACAGTGTCTTGCTCTGTGG + Intronic
1150734402 17:67723884-67723906 TGAGACAGGGTCTTGCTCTGTGG - Intronic
1150734635 17:67726064-67726086 TGAGACAGGGTCTCACTCTGTGG - Intronic
1150903071 17:69304020-69304042 TGAGACAGGGTCTTGCTCTGTGG - Intronic
1151297268 17:73194420-73194442 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1151405028 17:73880632-73880654 TGAGACAGGGTCTGGCTCTGTGG + Intergenic
1151471994 17:74324350-74324372 CAAGACAGGGTCTCACTCTGTGG - Intergenic
1151606113 17:75137374-75137396 TGAGACAGGGTCTCACTCTGTGG + Intronic
1151650965 17:75469222-75469244 GAAGTCAGTGCCTCGTTCTGGGG + Intronic
1151732345 17:75918929-75918951 AGAGACAGGGTTTTGTTCTGTGG + Intronic
1151797957 17:76359125-76359147 AGAGACAGGGTCTCGCTCTGTGG - Intronic
1151925684 17:77194530-77194552 TGAGACAGGGTCTCGCTTTGTGG - Intronic
1152127094 17:78453705-78453727 TGAGACAGGGTCTCATTCTCTGG + Intronic
1152266821 17:79299922-79299944 TGAGACAGTGTCTCGCTCTGTGG + Intronic
1152369395 17:79877086-79877108 AGAGACAGGGTCTCACTCTGTGG - Intergenic
1152429281 17:80238843-80238865 GGAGACAGAGTCTCACTCTGTGG + Intronic
1152508250 17:80767349-80767371 GGAGACAGGGTCTCACTCTGTGG - Intronic
1152712471 17:81879983-81880005 TGAGACAGGGTCTTGCTCTGCGG - Intergenic
1152774603 17:82193076-82193098 TGAGACAGGGTCTCATTCTATGG + Intronic
1152782833 17:82233858-82233880 TGAGACAGAGTCTCGCTCTGTGG + Exonic
1152787481 17:82256491-82256513 TTTGACAGGGTCTTGCTCTGTGG - Intronic
1152808401 17:82369526-82369548 TGAGACAGGGTCTCGCTCTAAGG - Intergenic
1152882386 17:82825944-82825966 TTAGACAGGGTCTCGCTCACTGG - Intronic
1152968433 18:138405-138427 TGAGACAGGGTCTTGCTCTGTGG - Intergenic
1153014990 18:575545-575567 TAAGACAGGGTCCCATTCTGGGG - Intergenic
1153022045 18:637945-637967 CAAGACAGAGTCTCGCTCTGAGG - Intronic
1153038412 18:787114-787136 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1153242194 18:3041225-3041247 GGAGACGGGGTCTCACTCTGTGG - Intergenic
1153527614 18:6012751-6012773 AGAGACAGGGTCTTGCTCTGTGG - Intronic
1153679782 18:7489711-7489733 TTAGACAGGGTCTCATTCTGTGG - Intergenic
1153787481 18:8547724-8547746 ATAGACAGAGTCTCACTCTGTGG + Intergenic
1153839790 18:8996482-8996504 TGAGACAGGGTCTCACTCTGTGG + Intergenic
1154086794 18:11313524-11313546 AGAGACAGGGTCTGGCTCTGTGG + Intergenic
1154168294 18:12032602-12032624 AGAGACAGGGTCTCATTCTGTGG - Intergenic
1154489584 18:14909425-14909447 TTAGACAGTGTCTTGCTCTGTGG + Intergenic
1154952304 18:21222150-21222172 TGAGACAGGGTCTTGCTCTGTGG - Intergenic
1155048746 18:22128416-22128438 TGAGACAGGGTCTCACTCTGTGG + Intergenic
1155216804 18:23650327-23650349 GTAGAGAGGTTCTCGCTGTGTGG + Intronic
1155741043 18:29288236-29288258 TGAGACAGGGTCTCACTCTGTGG + Intergenic
1155943488 18:31823003-31823025 TAAGACAGGGTCTTGTTATGTGG - Intergenic
1155981236 18:32182048-32182070 TGAGACAGGTTCTTGTTCTGTGG - Intronic
1156009020 18:32474935-32474957 TGAGACAGGGTCTCTCTCTGTGG + Intergenic
1156426838 18:37023048-37023070 AGAGACAGGGTCTCACTCTGTGG + Intronic
1156466729 18:37352571-37352593 AGAGGCAGGGTCTCATTCTGTGG - Intronic
1157397976 18:47359300-47359322 TGAGACAGAGTCTTGTTCTGTGG + Intergenic
1157552585 18:48591765-48591787 AGAGACAGGGTCTCGCTCTGTGG + Intronic
1157766298 18:50299519-50299541 TGAGACAGGGTCTGGCTCTGTGG - Intergenic
1158058765 18:53313263-53313285 GAAGACAGAGTCTCGCTCTGTGG + Intronic
1158348784 18:56543009-56543031 TCAGACAGGGTCTCGCTCTGTGG + Intergenic
1158567949 18:58571044-58571066 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1158606509 18:58900836-58900858 GGATACAGGGTTTCTTTCTGAGG - Intronic
1158681309 18:59569648-59569670 AGAGACAGGGTCTTGCTCTGTGG + Intronic
1158986419 18:62822299-62822321 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1159526198 18:69593350-69593372 AGAGACAGGGCCTTGTTCTGTGG - Intronic
1159610531 18:70520227-70520249 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
1160207663 18:76848683-76848705 AGAGACAGGGTCTTGCTCTGTGG + Intronic
1160279082 18:77470129-77470151 AGAGACAGGGTCTCACTCTGTGG - Intergenic
1160283553 18:77517592-77517614 TTAGACAGGGTCTTGCTTTGTGG - Intergenic
1160287085 18:77553808-77553830 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
1160567236 18:79794265-79794287 TGAGACAGGGTCTTGTTCTGTGG - Intergenic
1160705269 19:526606-526628 TTAGACAGGGTCTCGCTCTGTGG + Intergenic
1160706024 19:530799-530821 TGAGACAGAGTCTCGTTCTGTGG - Intergenic
1160752730 19:742135-742157 TGAGACAGGGTCTTGGTCTGTGG - Intronic
1160784652 19:894053-894075 TGAGACAGGGTCTCGCTCTGTGG + Intergenic
1160797411 19:952420-952442 TGAGACAGGGTCTCGCTCTGTGG - Intronic
1160801035 19:969061-969083 AGAGACAGGGTCTCGGTCTGTGG - Intronic
1160913482 19:1485990-1486012 TGAGACAGGGTCTCGCTCTGTGG + Intronic
1160998603 19:1897077-1897099 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1161128943 19:2576867-2576889 AAAGACAGGGTCTCGCTATGTGG + Intronic
1161174479 19:2832725-2832747 TAAGACAGGGTCTCACTCTGTGG + Intronic
1161336753 19:3718486-3718508 GTGGACAGGGCCTCACTCTGTGG + Intronic
1161354596 19:3811778-3811800 AGAGACAGGGTCTCGCTCTGTGG + Intronic
1161374447 19:3932196-3932218 TGAGACAGGGTCTCGCTCTGTGG - Intergenic
1161451209 19:4346435-4346457 TGAGACAGGGTCTCACTCTGTGG + Intronic
1161605286 19:5211538-5211560 GTAGAGATGGGCTCCTTCTGGGG + Intronic
1161692801 19:5746822-5746844 GGAGACAGTGTCTCACTCTGTGG + Intronic
1161709631 19:5840796-5840818 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
1161868409 19:6852031-6852053 AGAGACAGGGTCTTGCTCTGTGG + Intronic
1161894260 19:7068848-7068870 TGAGACAGGGTCTCACTCTGTGG - Intergenic
1161977459 19:7614364-7614386 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1162085423 19:8246063-8246085 TTAGACAGGGTCTCACTCTGTGG - Intronic
1162113892 19:8416587-8416609 TGAGACAGGGTCTTGCTCTGTGG + Intronic
1162561473 19:11420310-11420332 TGAGACAGGGTCTGGCTCTGTGG + Intergenic
1162586834 19:11564933-11564955 TGAGACAGGGTCTCACTCTGTGG + Intronic
1162635002 19:11961091-11961113 TAAGACAGGGTCTCCCTCTGTGG - Intronic
1162648612 19:12067890-12067912 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1162657635 19:12143490-12143512 TGAGACAGAGTCTTGTTCTGTGG - Intronic
1162920738 19:13900992-13901014 AGAGACAGGGTTTTGTTCTGTGG + Intronic
1162953666 19:14086433-14086455 ATAGACAGGGTCTTGCTATGTGG - Intergenic
1163113649 19:15176741-15176763 TAAGACAGGGTCTTGCTCTGTGG - Intronic
1163241805 19:16068195-16068217 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1163247907 19:16108695-16108717 TGAGACAGGGTCTTGTTCTGTGG - Intergenic
1163279762 19:16308496-16308518 GGGGACAGGGTCTCCTTTTGTGG + Intergenic
1163348607 19:16760980-16761002 GGGGACAGGGTCTCCTTTTGGGG - Intronic
1163352308 19:16785108-16785130 GGGGACAGGGTCTCCTTCTGGGG + Intronic
1163422366 19:17220975-17220997 TGAGACAGGGTCTCGCTCTGTGG + Intergenic
1163465426 19:17465479-17465501 TGAGACAGGGTCTCAGTCTGTGG - Intergenic
1163480169 19:17550644-17550666 TGAGACAGGGTCTCTCTCTGTGG - Intronic
1163556321 19:17995190-17995212 TGAGACAGGGTCTTGCTCTGTGG + Intronic
1163564553 19:18042845-18042867 GGAGACAGGGTCTCACTCTGTGG - Intergenic
1163565745 19:18050068-18050090 GGAGACAGAGTCTCGCTCTGTGG - Intergenic
1163682124 19:18688858-18688880 GGGGACAGGGTCTCTTTCTGGGG - Intronic
1163693123 19:18748055-18748077 GGAGACAGGGTCTCGCTCTGTGG - Intronic
1163717554 19:18880716-18880738 TGAGACAGGGTCTTGCTCTGTGG + Intronic
1163745136 19:19042366-19042388 CAAGACAGGGTCTCACTCTGTGG + Intronic
1163756138 19:19107294-19107316 GGAGACAGGGTCTCACTCTGTGG - Intronic
1163823891 19:19512079-19512101 TGAGACAGGGTCTCACTCTGTGG + Intergenic
1163924930 19:20331389-20331411 GTAGACGGAGTCTCGCTCTTTGG - Intergenic
1164437092 19:28239964-28239986 AGAGACAGGGTCTTGCTCTGTGG - Intergenic
1164765214 19:30759567-30759589 AGAGACAGGGTCTCCCTCTGTGG + Intergenic
1164957475 19:32399185-32399207 GGAGACAGGGTCTTGCCCTGTGG - Intergenic
1164991529 19:32687973-32687995 TGAGACAGGGTCTCACTCTGCGG - Intergenic
1165347591 19:35258583-35258605 AGAGACAGGGTCTCACTCTGTGG - Intronic
1165414727 19:35685704-35685726 TGAGACAGGGTCTCACTCTGTGG + Intergenic
1165436933 19:35800710-35800732 TTAGACAGGGTCTAGCCCTGTGG + Intronic
1165456315 19:35912987-35913009 TGAGACAGGGTCTCACTCTGTGG - Intergenic
1165461669 19:35947474-35947496 GGAGACAGGGTGTCGTTCTGTGG - Intergenic
1165474264 19:36020871-36020893 AGAGACAGGGTCTCACTCTGTGG + Intronic
1165568190 19:36751044-36751066 TAAGACAGGGTCTTGCTCTGTGG - Intronic
1165672903 19:37694650-37694672 TAAGACAGGGTCTAGGTCTGTGG - Intronic
1165697317 19:37910622-37910644 TTAGACAGAGTCTTGCTCTGTGG + Intronic
1165811289 19:38613503-38613525 AGAGACAGGGTCTCACTCTGTGG - Intronic
1165848378 19:38833893-38833915 TTAGACAGAGTCTTGCTCTGTGG - Intronic
1166006259 19:39909325-39909347 TGAGACAGGGTCTCGATCTGTGG + Intronic
1166221584 19:41368451-41368473 TGAGACAGAGTCTCGTTCTGTGG + Intronic
1166265071 19:41676378-41676400 GGAGACAGGGTCTTGCTCTGTGG + Intronic
1166510693 19:43406946-43406968 TTTGACAGGGTCTCATTCTGTGG + Intronic
1166628267 19:44381084-44381106 GAAGACAGTGTCTCCCTCTGGGG - Intronic
1166695661 19:44850175-44850197 TGAGACAGGGTCTTGCTCTGTGG - Intronic
1166776958 19:45318878-45318900 TGAGACAGGGTCTCACTCTGTGG + Intronic
1166928564 19:46286818-46286840 TGAGACAGGGTCTCACTCTGTGG + Intergenic
1167130736 19:47583880-47583902 TGAGACAGGGTCTCACTCTGTGG + Intergenic
1167456447 19:49598795-49598817 TGAGACAGGGTCTCACTCTGTGG - Intronic
1167536128 19:50052729-50052751 TGAGACAGAGTCTCATTCTGTGG - Intronic
1167687421 19:50965302-50965324 TTAGACAGAGTCTCGCTCTGTGG + Intronic
1167701300 19:51048181-51048203 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1167789117 19:51660774-51660796 TGAGACAGGGTCTCGCTCTGTGG - Intergenic
1168077467 19:53989245-53989267 TGAGACAGGGTCTTGCTCTGTGG - Exonic
1168087731 19:54060708-54060730 TGAGACAGGGTCTCACTCTGTGG + Intronic
1168237510 19:55072530-55072552 TGAGACAAGGTCTAGTTCTGTGG - Intronic
1168260332 19:55189972-55189994 CAAGACAGGGTCTCACTCTGTGG - Intronic
1168288088 19:55344340-55344362 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1168331302 19:55571033-55571055 AGAGACAGGATCTTGTTCTGTGG + Intergenic
1168445297 19:56406550-56406572 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1168506472 19:56939392-56939414 AGAGACAGGGTCTTGTTATGTGG - Intergenic
1168511691 19:56978768-56978790 TGAGACAGGGTCTTATTCTGCGG + Intergenic
1168527235 19:57099037-57099059 TGAGACAGGGTCTCACTCTGTGG - Intergenic
1202690805 1_KI270712v1_random:94652-94674 ATAGACAAGGTCCTGTTCTGTGG + Intergenic
924994803 2:349474-349496 TGAGACAGGGTCTCTCTCTGTGG - Intergenic
925103495 2:1269499-1269521 TGAGACAGGGTCTCACTCTGTGG - Intronic
925708068 2:6709508-6709530 GTGTACAGGGTTTCTTTCTGAGG + Intergenic
925923288 2:8652513-8652535 TGAGACAGGGTCTGGCTCTGTGG - Intergenic
925955445 2:8959479-8959501 TAAGACAGGGTCTTGCTCTGTGG + Intronic
926081892 2:9994162-9994184 AGAGACAGGGTCTTGCTCTGAGG + Intronic
926107449 2:10161085-10161107 TGACACAGGGTCTCGCTCTGTGG + Intronic
926134176 2:10325163-10325185 AGAGAGAGGGTCTCGCTCTGTGG + Intronic
926301997 2:11611330-11611352 TGAGACAGGGTCTCACTCTGTGG + Intronic
926356929 2:12049066-12049088 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
926546829 2:14251964-14251986 TGAGACAGGGTCTCACTCTGTGG + Intergenic
927165551 2:20317009-20317031 TGAGACAGAGTCTCGCTCTGTGG - Intronic
927214973 2:20663226-20663248 GGAGACAGGGTCTCCCTCTGTGG - Intergenic
927588990 2:24336220-24336242 TGAGACAGAGTCTCGCTCTGTGG - Intronic
927640682 2:24843702-24843724 AAAGACAGGGTTTGGTTCTGAGG + Intronic
927694381 2:25230353-25230375 GTAGCCAGGTGCTCGTGCTGGGG - Exonic
927746987 2:25632171-25632193 TGAGACAGAGTCACGTTCTGTGG - Intronic
927941748 2:27107912-27107934 TGAGACAGAGTCTCGCTCTGTGG - Intronic
927999531 2:27511045-27511067 TGAGACAGAGTCTCGCTCTGTGG + Intronic
928301361 2:30128063-30128085 TTTGACAGGGTCTTGCTCTGTGG + Intergenic
928515481 2:32040975-32040997 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
928519562 2:32075404-32075426 TGAGACAGAGTCTCGCTCTGTGG - Intronic
928570644 2:32604909-32604931 TGAGACAGGGTCTCACTCTGTGG + Intronic
928951282 2:36815314-36815336 GGAGACAGAGTCTCACTCTGTGG - Intergenic
928965568 2:36971712-36971734 TGAGACAGGGTCTTGCTCTGTGG + Intronic
929158987 2:38812865-38812887 TGAGACAGAGTCTCGGTCTGTGG + Intronic
929160507 2:38827464-38827486 TGAGACAGAGTCTCGCTCTGTGG - Intronic
929264381 2:39901949-39901971 AGAGACAGGGTCTTGATCTGTGG - Intergenic
929409838 2:41685554-41685576 TGAGACAGAGTCTTGTTCTGTGG - Intergenic
929700599 2:44159766-44159788 AGAGACTGGGTCTCGTTGTGTGG + Intergenic
930185907 2:48411810-48411832 TTAGACAGAGTCTCGCTCTGTGG + Intergenic
930612625 2:53560397-53560419 TTAGACAGGGTCTCACTCTGTGG + Intronic
930627468 2:53713891-53713913 TGAGACAGGGTCTCACTCTGTGG - Intronic
930799711 2:55430208-55430230 TGAGACAGGGTCTCACTCTGTGG - Intergenic
931351496 2:61493485-61493507 GGAGACAGGGTCTTGCTCTGTGG - Intronic
931438759 2:62272069-62272091 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
931566739 2:63622548-63622570 GTAGTCATGGTCTGATTCTGTGG + Intronic
931787453 2:65632961-65632983 TGAGACAGGGTCTCATTCTGTGG + Intergenic
932006123 2:67928780-67928802 CTAGACAGGGTCCCACTCTGTGG - Intergenic
932200634 2:69824481-69824503 TGAGACGGAGTCTCGTTCTGTGG - Intronic
932213113 2:69948226-69948248 TGAGACAGGGTCTCACTCTGTGG - Intergenic
932219749 2:69990495-69990517 GTAGACAGGGTCTCACTCTGCGG + Intergenic
932227917 2:70057812-70057834 TTAGACAGAGTCTCGCTCTGTGG + Intergenic
932298172 2:70643810-70643832 AGAGACAGGGTCTCGCTATGTGG + Intronic
932444962 2:71774463-71774485 AGAGACAGGGTCTCACTCTGTGG + Intergenic
932487677 2:72094344-72094366 GGAGACAGAGTCTCATTCTGTGG - Intergenic
932562543 2:72886296-72886318 TTTGACAGAGTCTCGCTCTGTGG - Intergenic
932708027 2:74041879-74041901 GTAAACAGGGTCTCATACTTAGG - Intronic
932723626 2:74158757-74158779 TGAGACAGGGTCTCACTCTGTGG - Intronic
933821200 2:86113779-86113801 GGGGACAGGGTCTCACTCTGTGG - Intronic
933847703 2:86338531-86338553 TGAGACAGAGTCTCGCTCTGGGG + Intergenic
933955589 2:87359300-87359322 ATAGACAAGGTCCTGTTCTGTGG - Intergenic
934058020 2:88268899-88268921 GGAGACAAGGTCTTGCTCTGTGG + Intergenic
934239774 2:90255531-90255553 ATAGACAAGGTCCTGTTCTGTGG - Intergenic
934273421 2:91561229-91561251 ATAGACAAGGTCCTGTTCTGTGG + Intergenic
934462215 2:94218865-94218887 ATAGACAAGGTCCTGTTCTGTGG - Intergenic
934689686 2:96348673-96348695 TGAGACAGGGTCTCGCTCTGTGG + Intronic
934719976 2:96567124-96567146 TAAGACAGAGTCTCGCTCTGTGG + Intergenic
934785324 2:97001005-97001027 TGAGACAGAGTCTCGCTCTGTGG + Intronic
934892336 2:98081629-98081651 TGAGACAGTGTCTCGCTCTGTGG + Intergenic
935001577 2:99022303-99022325 TGAGACAGGGTCTCCTTCAGTGG - Intronic
935030790 2:99320025-99320047 TGAGACAGGGTCTCACTCTGTGG + Intronic
935146505 2:100399121-100399143 TGAGACGGAGTCTCGTTCTGTGG + Intronic
935570795 2:104658885-104658907 TGAGACAGGGTCTCACTCTGGGG + Intergenic
935583448 2:104779674-104779696 TGAGACAGGGTCTCCCTCTGTGG - Intergenic
935706265 2:105860264-105860286 TGAGACAGGGTCTCACTCTGTGG - Intronic
935853910 2:107254867-107254889 TTTGACAGGGTCTCGCTCTGTGG - Intergenic
936349690 2:111703310-111703332 TGAGACAGGGTCTCACTCTGTGG - Intergenic
936764918 2:115835114-115835136 TTAGACAGAGTCTTGCTCTGTGG - Intronic
937045034 2:118846697-118846719 GTGGACAGGGTCTCTACCTGCGG + Exonic
937175842 2:119933641-119933663 TGAGACAGGGTCTCACTCTGTGG - Intronic
937366499 2:121265883-121265905 TGAGACAGGGTCTCACTCTGTGG + Intronic
937807775 2:126166033-126166055 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
937824292 2:126348461-126348483 TGAGACAGGGTCTCATTCTTAGG - Intergenic
937927979 2:127182564-127182586 TGAGACAGAGTCTCGTTCTGTGG - Intergenic
938017816 2:127882611-127882633 GGAGACAGGGTCTCCGTCTGCGG + Intronic
938030546 2:127989116-127989138 GGAGACAGAGTCTCACTCTGTGG + Intronic
938561672 2:132477544-132477566 TTAGACAAGGTCTTGCTCTGTGG - Intronic
938902672 2:135811174-135811196 TTAGACAGGGTCTTGCTCTGAGG - Intronic
939521715 2:143239662-143239684 AGAGACAGGGTCTCGATATGTGG - Intronic
939627756 2:144498883-144498905 AGAGACAGGGTCTCACTCTGTGG - Intronic
939995081 2:148912462-148912484 GGAGTCAGGGTCTTGCTCTGTGG + Intronic
940035998 2:149312585-149312607 GGAGACAGGGTCTCACTCTGAGG + Intergenic
940346362 2:152633113-152633135 TTAGACAGGGTCTTGCTCTGTGG + Intronic
940775583 2:157879962-157879984 GGAGACAGAGTCTCGCTCTGTGG - Intronic
940902948 2:159143041-159143063 TGAGACAGAGTCTCGCTCTGTGG - Intronic
940941754 2:159570202-159570224 GGAGACAGACTCTCGCTCTGTGG + Intronic
940954765 2:159714899-159714921 AGAGACAGGGTCTCACTCTGTGG - Intronic
941172911 2:162161998-162162020 TAAGACAGAGTCTCGCTCTGTGG + Intergenic
941384216 2:164833332-164833354 TGAGACAGGGTCTTGCTCTGTGG - Intronic
941408178 2:165118604-165118626 TGGGACAGGGTCTCATTCTGTGG + Intronic
941756766 2:169194739-169194761 GGAGACAGAGTCTCACTCTGTGG + Intronic
941785334 2:169491814-169491836 TGAGACAGAGTCTCGCTCTGTGG + Intronic
941828141 2:169922264-169922286 ATAGACAGGGTCTCACTCTGTGG - Intronic
941965573 2:171297144-171297166 AGAGACAGGGTCTCCTTATGTGG - Intergenic
942003843 2:171678140-171678162 GGAGACAGGGTTTCGCTCTGTGG + Intergenic
942005940 2:171699657-171699679 AGAGACAGGGTCTCAGTCTGTGG + Intronic
942007369 2:171718451-171718473 TGAGACAGAGTCTCGCTCTGTGG + Intronic
942040851 2:172060471-172060493 GTAAACAGTGGCTCTTTCTGTGG - Intronic
942128419 2:172850596-172850618 TGAGACAGAGTCTCGCTCTGTGG - Intronic
942293273 2:174493165-174493187 TTAGACAGAGTCTTGCTCTGTGG - Intergenic
942551037 2:177119458-177119480 TGAGACAGGGTCTCATTCTGTGG - Intergenic
942748242 2:179260494-179260516 TGAGACAGGGTCTCACTCTGTGG - Intronic
943755822 2:191555975-191555997 TGAGACAGGGTCTCACTCTGTGG + Intergenic
943875511 2:193062215-193062237 AGAGACAGGGTCTCATTATGTGG - Intergenic
944161282 2:196662907-196662929 GGAGACAGGATCTCACTCTGTGG - Intronic
944170120 2:196765988-196766010 GGAGACAGAGTCTTGCTCTGTGG - Intronic
944578969 2:201116037-201116059 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
945079375 2:206073532-206073554 TGAGACAGGGTCTTGCTCTGTGG + Intronic
945120215 2:206449739-206449761 TGAGACAGAGTCTCATTCTGTGG - Intronic
945151154 2:206793199-206793221 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
945272355 2:207953802-207953824 GTAGACAGAGTCTTGCTTTGTGG - Intronic
945439190 2:209858672-209858694 GGAAACAGGGTTTCATTCTGTGG - Intronic
945691394 2:213041096-213041118 TGAGACAGGGTCTCACTCTGTGG - Intronic
945875970 2:215278722-215278744 TGAGACAGGGTCTTGCTCTGTGG - Intergenic
946444191 2:219723951-219723973 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
946608487 2:221432661-221432683 TGAGACAGAGTCTCATTCTGTGG + Intronic
946609164 2:221439505-221439527 AGAGACAGGGTCTGGCTCTGTGG + Intronic
946739479 2:222787870-222787892 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
946856111 2:223951497-223951519 TCAGACAGAGTCTCGCTCTGTGG + Intergenic
947067043 2:226239332-226239354 AGAGACAGGGTCTGGCTCTGTGG + Intergenic
947521500 2:230849553-230849575 CGAGACAGGGTCTCGCTCTGTGG - Intergenic
947548035 2:231025785-231025807 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
947633625 2:231668891-231668913 GAAGACTGGGTCTCGAACTGGGG - Intergenic
948485359 2:238277529-238277551 CTCGACAGGGCCTCGTTATGAGG + Intronic
948683326 2:239652675-239652697 TGAGACAGGGTCTCACTCTGTGG + Intergenic
948933430 2:241147599-241147621 TGAGACAGGGTCTTGCTCTGTGG - Intronic
1168754631 20:307845-307867 AGAGACAGGGTCTCACTCTGCGG - Intergenic
1168780482 20:485044-485066 GGAGACAAGGTCTTGCTCTGTGG - Intronic
1168799788 20:636988-637010 TGAGACAGAGTCTCGCTCTGGGG - Intergenic
1168811593 20:708270-708292 TGAGACAGGGTCTCATTCTGTGG + Intergenic
1169165314 20:3417980-3418002 TTAGACAGGGTCTGGCTCTGTGG - Intergenic
1169230305 20:3883959-3883981 TGAGACAGTGTCTCGCTCTGTGG + Intergenic
1169271456 20:4202535-4202557 TGAGACGGAGTCTCGTTCTGTGG - Intergenic
1169325527 20:4672437-4672459 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1169364455 20:4980549-4980571 TGAGACGGGGTCTCATTCTGTGG + Intronic
1169371717 20:5033073-5033095 ATAGATAGGGTCTTGCTCTGTGG - Intergenic
1169437403 20:5604931-5604953 CGAGACAGGGTCTTGCTCTGTGG - Intronic
1169637176 20:7705429-7705451 GAAGACACGGTCTTGCTCTGTGG + Intergenic
1169997816 20:11577993-11578015 GGAGACGGAGTCTCGCTCTGTGG - Intergenic
1170834200 20:19869643-19869665 AGAGACAGGGTCTCGCTCTGGGG + Intergenic
1170946264 20:20893853-20893875 TGAGACAGGGTCTCGCTCTGTGG + Intergenic
1170966113 20:21073147-21073169 AGAGACAGGGTCTCACTCTGTGG + Intergenic
1171004676 20:21453015-21453037 TGAGACAGGGTCTGGCTCTGTGG + Intergenic
1171295731 20:24015154-24015176 GGAGACAAGGTCTCGTTTTGTGG - Intergenic
1171329271 20:24323348-24323370 TAAGACAGGTTCTCTTTCTGTGG + Intergenic
1172084974 20:32374308-32374330 AGATACAGGGTCTCGCTCTGTGG + Intronic
1172191668 20:33065489-33065511 TGAGACAAGGTCTCATTCTGTGG - Intronic
1172280709 20:33705943-33705965 TTAGACACAGTCTCGCTCTGTGG + Exonic
1172364344 20:34337465-34337487 TGAGACAGGGTCTTGTTCTGTGG - Intergenic
1172500627 20:35424059-35424081 TGAGACAGGGTCTCCCTCTGTGG - Intergenic
1172547881 20:35775732-35775754 GGAGACAGAGTCTCACTCTGTGG - Intronic
1172549106 20:35785029-35785051 TAAGACAGGGTCTGTTTCTGTGG - Intronic
1172709158 20:36907109-36907131 GGAGACAAGGTCAGGTTCTGTGG + Intronic
1172739844 20:37157533-37157555 AGAGACAGGGTCTTGCTCTGTGG - Intronic
1173031474 20:39365110-39365132 AGAGACAGGGTCTCGTTATACGG - Intergenic
1173206348 20:40997534-40997556 TGAGACAGGGTCTCACTCTGTGG + Intergenic
1173211983 20:41041416-41041438 TGAGACAGGGTCTCGTTCTGGGG - Intronic
1173441708 20:43083378-43083400 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1173611022 20:44368184-44368206 TGAGACAGGGTCTCACTCTGTGG + Intronic
1173896452 20:46554710-46554732 TGAGACAGGGTCTCGCTTTGTGG - Intergenic
1173899813 20:46579308-46579330 GGAGACAGGCTCTTGTTATGTGG + Intronic
1174216549 20:48920916-48920938 TGAGACAGGGTCTCCTTCTGTGG + Intergenic
1174229368 20:49031896-49031918 TGAGACAGGGTCTTGCTCTGCGG - Intronic
1174251585 20:49223859-49223881 TGAGACAGGGTCTCATTCTGTGG - Intronic
1174366303 20:50058681-50058703 AAAGACAGGGTCTCGCTCTGTGG - Intergenic
1174431949 20:50476522-50476544 TCAGACAGAGTCTTGTTCTGTGG - Intergenic
1174474636 20:50787711-50787733 CTTGACAGGGTCTCACTCTGTGG - Intergenic
1175039851 20:56038475-56038497 GTAGACAGGGACCCATTTTGTGG + Intergenic
1175098384 20:56560143-56560165 TGAGACAGGGTCTCATTCTGTGG + Intergenic
1175223309 20:57430189-57430211 GGGGACAGGGTCTCCTTCTGGGG + Intergenic
1175411521 20:58772903-58772925 GGAGACAGGGTCATGCTCTGCGG + Intergenic
1176224319 20:63987148-63987170 TGAGACAGGGTCTCGCTCTGTGG - Intronic
1176593290 21:8661807-8661829 ATAGACAAGGTCCTGTTCTGTGG - Intergenic
1176725001 21:10423930-10423952 TGAGACGGAGTCTCGTTCTGTGG - Intergenic
1176979866 21:15369098-15369120 GAATACAGGGTTTCTTTCTGTGG - Intergenic
1177194406 21:17887531-17887553 AGAGACAAGGTCTTGTTCTGTGG - Intergenic
1177382235 21:20359754-20359776 TGAGACAGGGTCTCTCTCTGTGG - Intergenic
1177555958 21:22689142-22689164 TGAGACAGGGTCTCACTCTGTGG + Intergenic
1178333875 21:31726643-31726665 TGAGACAGGGTCTGGCTCTGTGG - Intronic
1178574815 21:33776524-33776546 TTGAACAGGGTCTCATTCTGTGG - Intronic
1178598763 21:33977969-33977991 AGAGACAGGGTCTCGCTCTGTGG - Intergenic
1178661042 21:34508044-34508066 TGAGACAGGGTCTTGCTCTGTGG + Intergenic
1178771234 21:35506099-35506121 TGAGACAGGGTCTCACTCTGGGG - Intronic
1178991670 21:37361764-37361786 TTAGACAGAGTCTCCCTCTGTGG - Intergenic
1178999462 21:37443167-37443189 AGAGACAGGGTCTTGCTCTGGGG + Intronic
1179368609 21:40782708-40782730 TTAGACAGGGTCTCACTCTATGG - Intronic
1179524664 21:41967836-41967858 GGAGACGGGGTGTCTTTCTGGGG + Intergenic
1179654368 21:42836250-42836272 TTAGATAGAGTCTCGCTCTGTGG + Intergenic
1179666452 21:42916071-42916093 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
1179788431 21:43742197-43742219 TGAGACAGGGTCTCACTCTGTGG + Intronic
1179793566 21:43769419-43769441 GTAGACAGGGTCTGGGTGGGGGG - Intergenic
1179815189 21:43901114-43901136 AGAGACAGGGTCTCGCTATGTGG - Intronic
1179875561 21:44265609-44265631 GGAGATAGAGTCTCGCTCTGTGG + Intergenic
1180227964 21:46408740-46408762 TGAGACAGAGTCTCATTCTGTGG + Intronic
1180276136 22:10638934-10638956 ATAGACAAGGTCCTGTTCTGTGG - Intergenic
1180550644 22:16533904-16533926 ATAGACAAGGTCCTGTTCTGTGG - Intergenic
1180626497 22:17197285-17197307 TGAGACAGGGTCTCACTCTGCGG + Intronic
1180632339 22:17238311-17238333 GGAGACAGAGTCTTGCTCTGTGG - Intergenic
1180788945 22:18563371-18563393 GGAGACAGGGTCTTGCTCTGTGG + Intergenic
1181103295 22:20555739-20555761 TGAGACGGGGTCTCGCTCTGTGG + Intronic
1181232791 22:21431949-21431971 GGAGACAGGGTCTTGCTCTGTGG - Intronic
1181245860 22:21502907-21502929 GGAGACAGGGTCTTGCTCTGTGG + Intergenic
1181297431 22:21851622-21851644 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1181354021 22:22287899-22287921 ATAGACAAGGTCCTGTTCTGTGG + Intergenic
1181517577 22:23424026-23424048 GGAGACAGTGTCTTGCTCTGTGG - Intergenic
1181858013 22:25796574-25796596 TTAGACAGGGTCTCACTCTACGG - Intronic
1182179311 22:28328732-28328754 TGAGACAGAGTCTCGATCTGTGG - Intronic
1182729200 22:32474150-32474172 TGAGACAGGGTCTCGTTCTGTGG + Intergenic
1182849640 22:33461266-33461288 AGAGACAGGGTCTCACTCTGTGG - Intronic
1183092235 22:35530492-35530514 GGAGACGGAGTCTCGCTCTGTGG + Intergenic
1183147594 22:36008791-36008813 TGAGACAGTGTCTCATTCTGTGG - Intronic
1183155439 22:36071410-36071432 AGAGACAGGGTCTTGCTCTGTGG + Intergenic
1183475343 22:38033137-38033159 TAAGACAGGGTCTCACTCTGGGG - Intronic
1183536684 22:38405835-38405857 TGAGACAGAGTCTTGTTCTGTGG + Intergenic
1183548230 22:38466804-38466826 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1183658215 22:39203123-39203145 TGAGACAGAGTCTCATTCTGTGG - Intergenic
1183758757 22:39796290-39796312 TGAGACAGGGTCTTGCTCTGTGG + Intronic
1183888538 22:40905810-40905832 TTAGACAGAGTCTCGCACTGTGG + Intronic
1184335759 22:43852200-43852222 GGAGGCAGGGTCTCTCTCTGTGG + Intronic
1184572030 22:45331393-45331415 ATAGACAGGGTCTTGCTCTGTGG + Intronic
1184578273 22:45392718-45392740 GGAGACAGAGTCTCACTCTGTGG + Intronic
1184590638 22:45480082-45480104 TGAGACAAGGTCTCGTTCTGTGG - Intergenic
1184748572 22:46471407-46471429 TGAGACAGAGTCTCATTCTGTGG + Intronic
1184862069 22:47177835-47177857 TGAGACAGGGTCTTGCTCTGTGG + Intergenic
949194557 3:1289692-1289714 TGAGACAGAGTCTCGCTCTGTGG + Intronic
949719410 3:6970960-6970982 TGAGACAGAGTCTCGCTCTGTGG - Intronic
950358755 3:12435127-12435149 AGAGACAGGGTCTCACTCTGTGG - Intergenic
950430998 3:12951089-12951111 AGAGGCAGGGTCTTGTTCTGTGG - Intronic
950582779 3:13873472-13873494 GTAGACAGGATCTCAGTATGGGG - Intronic
950622009 3:14213356-14213378 TTAGACAAGGTCTAGCTCTGTGG + Intergenic
950680321 3:14580680-14580702 TGAGACAGGGTCTCATTCTGTGG - Intergenic
950935100 3:16831497-16831519 GGGGACAGGGTTTCTTTCTGAGG + Intronic
951511246 3:23504926-23504948 TGAGACAGGGTCTCACTCTGGGG + Intronic
951586525 3:24220469-24220491 TGAGACAGGGTCTCACTCTGTGG - Intronic
951618578 3:24576059-24576081 TTTGACAGAGTCTCGCTCTGTGG + Intergenic
952295887 3:32061653-32061675 TAAGACAGGGTCTCAGTCTGTGG + Intronic
952356974 3:32593411-32593433 TTAGACAGAGTCTCTCTCTGTGG + Intergenic
952376574 3:32772675-32772697 TGAGACAGAGTCTTGTTCTGTGG - Intronic
952777471 3:37060326-37060348 TGAGACAGGGTCTCGCTCTGTGG + Intronic
952951075 3:38525922-38525944 TGAGACAGGGTCTCCCTCTGTGG - Exonic
953753015 3:45623838-45623860 AGAGACAGGGTCCCGTTTTGGGG - Intronic
953887835 3:46727396-46727418 TCAGACAGAGTCTCGTTCTGTGG - Intronic
953944382 3:47133711-47133733 TGAGACAGGGTCTCACTCTGTGG - Intronic
953995599 3:47517177-47517199 GGAGACAGAGTCTCACTCTGTGG + Intergenic
954033111 3:47834487-47834509 TGAGACAGGGTCTTGCTCTGTGG + Intronic
954062269 3:48078164-48078186 TTTGACAGGGTCTTGCTCTGTGG + Intronic
954270447 3:49503806-49503828 TGAGACAGGGTCTCACTCTGTGG - Intronic
954514023 3:51154994-51155016 GCAGTCAGGGTCTCACTCTGTGG + Intronic
954544739 3:51423480-51423502 GGAGACAGAGTCTCTCTCTGTGG - Intronic
954695014 3:52419447-52419469 TGAGACAGAGTCTTGTTCTGTGG + Intronic
954833832 3:53447333-53447355 TGAGACAAAGTCTCGTTCTGTGG + Intergenic
955173372 3:56587020-56587042 AGAGACAGGGTCTTGCTCTGTGG - Intronic
955364947 3:58302892-58302914 GGAGACAGGGTCTTACTCTGTGG - Intergenic
955748778 3:62166872-62166894 ATAGGCAGGGTCTCGTTGTCTGG + Intronic
955905853 3:63806969-63806991 TTAGACGGAGTCTCGCTCTGTGG + Intergenic
956096590 3:65722611-65722633 TGAGACAGGGTCTCGCTCTATGG - Intronic
956160226 3:66344093-66344115 GTAGACAGATTTTCTTTCTGTGG + Intronic
956431650 3:69192354-69192376 TGAGACAGGATCTCTTTCTGTGG - Intronic
956665648 3:71639685-71639707 AGAGACAGAGTCTCGCTCTGTGG + Intergenic
956828423 3:73020648-73020670 AGAGACAGGGTCTCACTCTGTGG - Intronic
957115208 3:76014906-76014928 AGAGACAGGGTCTCACTCTGTGG - Intronic
957695147 3:83626402-83626424 GGAGACAGGGTCTCTCTATGTGG - Intergenic
958263262 3:91407478-91407500 GGAGACAGGGTCTCACTCTGTGG + Intergenic
959573466 3:107909742-107909764 TTAGACAGAGTCTTGCTCTGTGG - Intergenic
959628696 3:108483178-108483200 GGAGACAGAGTCTTGCTCTGTGG - Intronic
959682945 3:109116758-109116780 GGAGACAGGGTCTTGCTCTGTGG - Intronic
959697270 3:109261827-109261849 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
959774722 3:110143859-110143881 AGAGATAGGGTCTCGCTCTGAGG - Intergenic
960923494 3:122773327-122773349 GGAGACAGAGTCTCACTCTGTGG + Intronic
960927883 3:122814246-122814268 TGAGACAGGGTCTTGCTCTGTGG - Intronic
961235191 3:125360304-125360326 TTAGACAGGGTCTCACTCTGTGG + Intronic
961364106 3:126388641-126388663 TGAGACAGGGTCTTGCTCTGTGG - Intergenic
961383224 3:126509214-126509236 AGAGACAGGGTCTCACTCTGTGG - Intronic
961538453 3:127584427-127584449 TTAGACAGGGTCTCACTCTGTGG - Intronic
961605176 3:128088620-128088642 TGAGACTGGGTCTTGTTCTGTGG + Intronic
962340108 3:134575330-134575352 GGAGACAGGGTCTCACTCTATGG + Intergenic
962340153 3:134575546-134575568 GGAGACAGGGTCTCACTCTGTGG + Intergenic
962340170 3:134575629-134575651 GGAGACAGGGTCTCACTCTGTGG + Intergenic
962405581 3:135097074-135097096 GTAGACAGAGTCTTGCTCTGTGG - Intronic
962856658 3:139352291-139352313 AAAGACAGGGTCTTATTCTGTGG + Intronic
962920991 3:139950297-139950319 GTTGAGAGGGTCACCTTCTGAGG + Intronic
963832329 3:150021586-150021608 TGAGACAGAGTCTCGCTCTGTGG - Intronic
963872574 3:150434049-150434071 TGAGACAGAGTCTCGCTCTGTGG - Intronic
964114064 3:153117494-153117516 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
964348304 3:155777458-155777480 TTAGACAGGGTCTCGCTCTGTGG + Intronic
964467176 3:157007179-157007201 TGAGACAGAGTCTCGCTCTGTGG - Intronic
964467906 3:157017927-157017949 TGAGACAGAGTCTCGCTCTGTGG - Intronic
964782538 3:160356538-160356560 AGAGACAGGGTCTCACTCTGTGG + Intronic
964859721 3:161187831-161187853 AGAGACAGGGTCTGGCTCTGTGG + Intronic
965535057 3:169814503-169814525 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
965592370 3:170373857-170373879 TGAGACAGGGTCTTGCTCTGGGG - Intronic
966847028 3:184138685-184138707 TGAGACAGGGTCTCGCTCTGTGG + Intronic
966918255 3:184596586-184596608 TGAGACAGAGTCTCGCTCTGTGG + Intronic
967163431 3:186759327-186759349 GAAGACAGGGTCTCACTCTGTGG - Intergenic
967175347 3:186857997-186858019 TTTGACAGACTCTCGTTCTGTGG + Exonic
967202199 3:187082056-187082078 TGAGACAGGGTCTTGCTCTGTGG + Intergenic
967895075 3:194388902-194388924 TGAGACAGGGTCTTGCTCTGTGG - Intergenic
967999380 3:195193266-195193288 TTAGACGGAGTCTCGCTCTGTGG - Intronic
968284053 3:197497930-197497952 TGAGACAGGGTCTCACTCTGGGG + Intergenic
968339557 3:197943617-197943639 TTTGACAGGGTCTCGCTCTGTGG - Intronic
968343652 3:197981350-197981372 GGACACAGGGTCTGGCTCTGTGG - Intronic
968681160 4:1921016-1921038 TAAGACAGGGTCTCACTCTGTGG - Intronic
968693913 4:2011346-2011368 TGAGACAGAGTCTCGCTCTGTGG - Intronic
968754148 4:2406350-2406372 TGAGACAGAGTCTTGTTCTGTGG - Intronic
969047591 4:4348147-4348169 TGAGACAGAGTCTTGTTCTGTGG + Exonic
969506195 4:7589420-7589442 TGAGACAGAGTCTCGCTCTGTGG + Intronic
970774326 4:19655148-19655170 TTAGACTGTGTCTCATTCTGTGG + Intergenic
970879184 4:20908117-20908139 TGAGACAGAGTCTCGCTCTGTGG + Intronic
971316345 4:25571409-25571431 GAAGACAGGGTCTCACTCTGTGG + Intergenic
971402624 4:26290297-26290319 TTAGACAGGGTCTCGTTCTGTGG - Intronic
971406412 4:26324548-26324570 TGAGACAGGGTCTCACTCTGTGG + Intronic
971648485 4:29239490-29239512 TTAGAGAGTGTCTCGCTCTGTGG + Intergenic
972530071 4:39953708-39953730 TGAGACAGGTTCTCGCTCTGTGG - Intronic
972585389 4:40432978-40433000 TGAGACAGGGTCTCACTCTGTGG + Intronic
972611648 4:40661103-40661125 TAAGACAGGGTCTCACTCTGTGG + Intergenic
972787793 4:42343853-42343875 CGAGACAGGGTCTTGCTCTGTGG - Intergenic
973321422 4:48814212-48814234 GTAGAAAGGGTCACCTCCTGTGG + Intronic
973338279 4:48978073-48978095 AGAGACAGGGTCTCACTCTGGGG - Intergenic
973901993 4:55484981-55485003 TGAGACAGGGTCTCCCTCTGTGG + Intronic
974039475 4:56845431-56845453 AGAGACAGGGTCTCCTTCTGTGG - Intergenic
974056170 4:56985252-56985274 TGAGACAGAGTCTCGCTCTGTGG + Intronic
974783423 4:66584959-66584981 AGAGACAGGGTCTCACTCTGTGG - Intergenic
974934059 4:68392493-68392515 TGAGACAGTGTCTCATTCTGTGG - Intergenic
975146088 4:70968632-70968654 TGAGACAAGGTCTCGTTCTTTGG + Intronic
975302895 4:72812173-72812195 TGAGACAGGGTCTCACTCTGCGG + Intergenic
975563424 4:75728816-75728838 TGAGACAGAGTCTCGCTCTGTGG + Intronic
975876962 4:78852622-78852644 AGAGACAAGGTCTCATTCTGTGG + Intronic
976296060 4:83473569-83473591 TGAGACACGGTCTCGCTCTGTGG + Intronic
976769698 4:88637404-88637426 GGAGACAGAGTCTCACTCTGTGG - Intronic
977207207 4:94176894-94176916 GTAGACAGAGTCTTGCTCTGTGG - Intergenic
977231836 4:94460599-94460621 TGAGACAGGGTCTGGTTCTGTGG - Intronic
977232275 4:94465979-94466001 TGAGACAGGGTCTTGCTCTGTGG + Intronic
977526775 4:98155740-98155762 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
977536131 4:98259081-98259103 TGAGACAGGGTCTTGCTCTGTGG + Intergenic
978067465 4:104422947-104422969 TGAGACAGGGTCTCGTTCTGTGG + Intergenic
978525024 4:109656393-109656415 GGAGACAGGGTTTCCCTCTGTGG + Intronic
978860562 4:113443447-113443469 TAAGACAGGGTCTCACTCTGTGG - Intergenic
979350671 4:119641052-119641074 TGAGACAGGGTCTCACTCTGTGG - Intergenic
980205535 4:129715344-129715366 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
980636890 4:135517979-135518001 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
980975989 4:139611047-139611069 TCAGACAGGGTCTCACTCTGTGG + Intergenic
981164304 4:141539557-141539579 GTAGATGGAGTCTCGCTCTGTGG + Intergenic
982140859 4:152316417-152316439 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
982261353 4:153496878-153496900 TGAGACAGGGTCTCATTATGTGG + Intronic
982507027 4:156232522-156232544 TGAGACTGGGTCTCGCTCTGTGG + Intergenic
983234479 4:165163694-165163716 TTAGATAGAGTCTCATTCTGAGG + Intronic
983265676 4:165505452-165505474 TGAGACAGAGTCTCGATCTGTGG + Intergenic
983356278 4:166661807-166661829 ATAGACAGGGTCTCATTATATGG + Intergenic
983572873 4:169229139-169229161 TGAGACAGGATCTTGTTCTGCGG + Intronic
983760670 4:171402049-171402071 TCAGACAGGGTCTCACTCTGTGG - Intergenic
983900052 4:173124165-173124187 TTAGACAGAGTCTTGTTCTGTGG + Intergenic
984555754 4:181211995-181212017 AAAGACAGGGTCTTGCTCTGTGG - Intergenic
984606206 4:181788615-181788637 AGAGACAGGGTCTCGCTCTGTGG + Intergenic
984617758 4:181917679-181917701 TGAGACAGGGTCTTGCTCTGTGG + Intergenic
984670128 4:182473936-182473958 GGAGACAGGGTCTCACTTTGTGG - Intronic
984833594 4:183999022-183999044 TGAGACAGGGTCTGGCTCTGTGG - Intronic
984906587 4:184633339-184633361 TTAGACAGGATCTTGCTCTGTGG + Intronic
984972395 4:185203179-185203201 TGAGACAGGGTCTCGCTCTGTGG - Intronic
985049552 4:185975272-185975294 TGAGACAGGGTCTCGTTCTGTGG + Intergenic
985384514 4:189431499-189431521 TGAGACAGGGTCTCGCTCTCTGG + Intergenic
985714463 5:1447495-1447517 CGAGACAGGGTCTCATCCTGTGG - Intergenic
985750880 5:1673771-1673793 TGAGACAGGGACTTGTTCTGTGG + Intergenic
986268979 5:6215433-6215455 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
986320668 5:6630323-6630345 TGAGACATGGTCTCGCTCTGTGG + Intronic
986704876 5:10446639-10446661 TGAGATAGAGTCTCGTTCTGTGG - Intronic
986974607 5:13380774-13380796 GTATCCAGAGTCTTGTTCTGAGG - Intergenic
987341444 5:16942975-16942997 TGAGACAGGGTCTGGCTCTGTGG - Intergenic
987370004 5:17184472-17184494 TGAGACAGGGTCTTGCTCTGTGG - Intronic
988050925 5:26030154-26030176 TTAGACAGAGTCTTGCTCTGTGG - Intergenic
988466312 5:31495895-31495917 CTGGACAGGGTCTTGTCCTGTGG + Intronic
988502143 5:31792436-31792458 TTAGACAGAGTCTCACTCTGTGG + Intronic
988552811 5:32211983-32212005 GGAGACAGAGTCTCACTCTGTGG + Intergenic
989051829 5:37328521-37328543 TGAGGCAGGGTCTCTTTCTGTGG + Intronic
989233706 5:39118416-39118438 GTAGACAGTGTCTCTTGCTCTGG - Intronic
989286373 5:39704833-39704855 TGAGACAGGGTCTCACTCTGTGG + Intergenic
989511824 5:42296525-42296547 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
989756558 5:44962173-44962195 GGAGACAGGGCCTCACTCTGTGG - Intergenic
990475188 5:56155828-56155850 TGAGGCAGGGTCTCATTCTGTGG - Intronic
991077245 5:62554733-62554755 GGAGACAGAGTCTAGCTCTGTGG + Intronic
991323187 5:65399234-65399256 TGAGACAGAGTCTCATTCTGTGG - Intronic
991706426 5:69362725-69362747 TGAGACAGGGTCTTGCTCTGTGG - Intronic
991713443 5:69430345-69430367 TGAGACAGAGTCTCGTTCTGTGG - Intronic
992129715 5:73679545-73679567 TGAGACAGAGTCTCGCTCTGTGG - Intronic
992288974 5:75265368-75265390 TTAGTCAGAGTCTCGCTCTGTGG + Intergenic
992321123 5:75613938-75613960 AAAGACAGGGTCTCGTTACGTGG - Intronic
992579546 5:78157767-78157789 TGAGACAGAGTCTTGTTCTGTGG + Intronic
992760363 5:79945807-79945829 AGAGACAGGGTCTTGCTCTGTGG - Intergenic
992892580 5:81217760-81217782 TGAGACAGAGTCTCGCTCTGTGG + Intronic
993145914 5:84093677-84093699 TCAGACGGGGTCTCGCTCTGTGG + Intronic
993216323 5:85027275-85027297 GTAGGCAGGGTCTCCTTATGTGG - Intergenic
995097374 5:108253952-108253974 TGAGACAGGGTCTTGCTCTGTGG - Intronic
995288633 5:110422498-110422520 TGAGACAGAGTCTCGCTCTGTGG - Intronic
995351227 5:111177830-111177852 TTTGACAGAGTCTCGCTCTGTGG - Intergenic
995485602 5:112637078-112637100 TGGGACAGGGTCTCGCTCTGTGG + Intergenic
995655441 5:114421308-114421330 TGAGACAGAGTCTCGCTCTGTGG + Intronic
996557485 5:124794168-124794190 TTAGACAGAGTCTCACTCTGTGG + Intergenic
996740967 5:126798428-126798450 TGAGACAGAGTCTCGCTCTGTGG - Intronic
997293730 5:132756519-132756541 GCAGACAGGGTCACATTCTATGG + Intronic
997328935 5:133045170-133045192 TGACACAGGGTCTCATTCTGTGG - Intergenic
997641128 5:135449614-135449636 GTCAACAGGGTCTCCTTCTCAGG - Exonic
997944782 5:138190436-138190458 GGAGTCAGAGTCTCATTCTGTGG - Intronic
998099234 5:139418188-139418210 TGAGACAGGATCTCGCTCTGTGG + Intronic
998105636 5:139467399-139467421 TGAGACAGGGTCTCACTCTGTGG - Intergenic
998244732 5:140489168-140489190 GGAGACAAGGTCTCGCTCTGTGG - Intronic
998344743 5:141451859-141451881 CTTGACAGGGTTTCATTCTGTGG - Intronic
998344826 5:141452675-141452697 CTTGACAGGGTTTCATTCTGTGG - Intronic
998579777 5:143359896-143359918 TGAGACGGAGTCTCGTTCTGTGG - Intronic
998819813 5:146048293-146048315 TGAGACAGGGTCTCACTCTGTGG - Intronic
999299030 5:150479061-150479083 TTTAACAGGGTCTTGTTCTGTGG - Intergenic
999307484 5:150529369-150529391 TGAGACAGGGTCTTGCTCTGTGG - Intronic
999771335 5:154778238-154778260 TTAGACGGAGTCTCGCTCTGTGG - Intronic
999787166 5:154901817-154901839 TGAGACAGGGTCTCACTCTGTGG + Intronic
999897896 5:156054303-156054325 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1000324562 5:160162440-160162462 TGAGACAGGGTCTCGCTCTGTGG + Intergenic
1000329431 5:160195472-160195494 TGAGACAGGGACACGTTCTGTGG + Intronic
1000365280 5:160484973-160484995 TTTGACAGGGTCTCTCTCTGTGG + Intergenic
1001520292 5:172386648-172386670 TGAGACAGGGTCTGGCTCTGTGG + Intronic
1002159173 5:177304794-177304816 GTAGTCATGGTCTGATTCTGTGG - Exonic
1002200069 5:177523037-177523059 TGAGACGGAGTCTCGTTCTGTGG + Intronic
1002436070 5:179231893-179231915 AGAGACAGGGTCTCGCTCTGTGG - Intronic
1002702311 5:181133209-181133231 AGAGACAGGGTCTTGCTCTGTGG + Intergenic
1002871230 6:1168934-1168956 AGAGACAAGGTCTCGCTCTGTGG + Intergenic
1002941770 6:1723344-1723366 TTAGACGGAGTCTCGCTCTGTGG + Intronic
1003073910 6:2966838-2966860 AGAGACAGGGTCTCGCTCGGTGG + Intronic
1003302639 6:4898200-4898222 TGAGACAGGGTCTTGCTCTGTGG - Intronic
1003530719 6:6935273-6935295 AGAGACAGGGTCTCGCTCTGTGG - Intergenic
1003601154 6:7518843-7518865 TGAGACAGGGTTTCCTTCTGTGG + Intergenic
1003879584 6:10467846-10467868 GGAGACAGAGTCTCACTCTGTGG - Intergenic
1004547372 6:16611008-16611030 AGAGACAGGGTCTTGCTCTGTGG - Intronic
1004560017 6:16740716-16740738 AGAGACAGGGTCTCACTCTGTGG + Intronic
1004644291 6:17544557-17544579 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1004716139 6:18218138-18218160 TGAGACAGGGTCTCGCTCTGTGG + Intronic
1004920135 6:20368554-20368576 TGAGACAGAGTCTCATTCTGTGG + Intergenic
1005077828 6:21925962-21925984 TGAGACAGGGTCTTGCTCTGTGG - Intergenic
1005381789 6:25242575-25242597 TGAGACAGGGTCTCACTCTGTGG - Intergenic
1005439679 6:25853433-25853455 GGAGACAGAGTCTCGCTCTGTGG + Intronic
1005470858 6:26160847-26160869 TGAGACAGAGTCTCATTCTGTGG - Intronic
1005584504 6:27262577-27262599 TTAGACAGAGTCTGGCTCTGTGG + Intergenic
1005609530 6:27510317-27510339 CAAGACGGGGTCTCATTCTGTGG + Intergenic
1005681346 6:28211884-28211906 TTTGACAGGGTCTCATTCTGTGG + Intergenic
1006345185 6:33475281-33475303 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1006466980 6:34201620-34201642 TTACACAGGGTCTCACTCTGTGG + Intergenic
1006669568 6:35721325-35721347 GGAGACAGAGTCTCGCTCTGTGG - Intronic
1006673130 6:35742475-35742497 TGAGACAGAGTCTCGTTCTGTGG - Intronic
1006816874 6:36857459-36857481 GGAGTCAGGGTCTCGCTCTGTGG - Intronic
1006912527 6:37572653-37572675 TGAGACAGGGTCTCACTCTGTGG + Intergenic
1007164731 6:39821333-39821355 GCAGACAGGGAGTCCTTCTGTGG - Intronic
1007240099 6:40418596-40418618 GAAGCCAGGGTCTAGTTCTGAGG - Intronic
1007524528 6:42480307-42480329 TGAGACAGGGTCTCGCCCTGGGG + Intergenic
1007531200 6:42544364-42544386 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
1007565708 6:42848797-42848819 TGAGACAGGGTCTCACTCTGTGG - Intronic
1007712621 6:43834368-43834390 TGAGACAGGGTCTCACTCTGTGG + Intergenic
1008077034 6:47155854-47155876 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
1008107348 6:47453672-47453694 TGAGACAGGGTCTTGCTCTGTGG + Intergenic
1008180175 6:48318522-48318544 TTAGACAGGGTCTTGCTCTGTGG - Intergenic
1008872871 6:56292147-56292169 TGAGACAGAGTCTCATTCTGCGG - Intronic
1009180763 6:60514504-60514526 GGAGACAGGGTCTCACTCTGTGG - Intergenic
1010233728 6:73557818-73557840 TGAGACAGGGTCTCGCTGTGTGG + Intergenic
1010409781 6:75547691-75547713 GCAGACAGAGTCTTGCTCTGTGG - Intergenic
1010427039 6:75739285-75739307 TGAGACAGGGTCTTGCTCTGTGG + Intergenic
1010699104 6:79020756-79020778 TGAGACGGAGTCTCGTTCTGTGG + Intronic
1011614183 6:89182854-89182876 AGAGACAGGGTCTCATTCTGTGG - Intronic
1011659217 6:89579735-89579757 TGAGACAGGGTCTTGCTCTGTGG - Intronic
1011883618 6:92063094-92063116 TGAGACAGGGTCTTGCTCTGTGG + Intergenic
1011901514 6:92303676-92303698 TGAGACAGAGTCTCGTTCTGTGG + Intergenic
1012111910 6:95245855-95245877 TAAGACAGAGTCTCATTCTGTGG + Intergenic
1012188690 6:96253931-96253953 TGAGACAGGGTCTTGTTCTGTGG - Intergenic
1012215573 6:96578820-96578842 TGAGACAGGGTCTCACTCTGTGG - Intronic
1012246919 6:96936758-96936780 GTATACAGGGTCTGGTTCTTGGG - Intronic
1012501830 6:99896676-99896698 TGAGACAGGGTCTCCCTCTGTGG - Intergenic
1012771556 6:103442043-103442065 TGAGACAGAGTCTCGTTCTGTGG + Intergenic
1012977557 6:105796225-105796247 GTAGCCAGTGTCACCTTCTGGGG - Intergenic
1012991737 6:105933383-105933405 TTAGACAGAGTCTCGCTCTGTGG + Intergenic
1013068311 6:106704814-106704836 TTAGACAGAGTCTCATTCTGTGG - Intergenic
1013108864 6:107049105-107049127 ATAGACATGGGCTTGTTCTGGGG + Intronic
1013156844 6:107500358-107500380 TTAGACAGGGTCTCACTCTGTGG - Intronic
1013209479 6:107973949-107973971 TGAGACAGGGTCTCGTTCTGTGG + Intergenic
1013398831 6:109771486-109771508 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1014029693 6:116686088-116686110 TGAGACAGGGTCTCATTGTGTGG + Intronic
1014071985 6:117192810-117192832 TGAGACAGGGTCTCCCTCTGTGG + Intergenic
1014254104 6:119144312-119144334 TGAGTCAGAGTCTCGTTCTGTGG - Intronic
1014869123 6:126569194-126569216 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1014874772 6:126643901-126643923 GTAGTCATGGTCTGATTCTGTGG - Intergenic
1015041939 6:128731655-128731677 GAAGGCAGGGCCTGGTTCTGTGG + Intergenic
1015221929 6:130813870-130813892 GGAGACGGAGTCTCGCTCTGTGG - Intergenic
1015322722 6:131894303-131894325 TGAGACAGAGTCTCGCTCTGTGG + Exonic
1015689820 6:135909584-135909606 GGAGACAGGGTCTCATTCTGTGG - Intronic
1015761081 6:136661724-136661746 GTAGAGACGGTCTCATTCTGTGG + Intronic
1015841587 6:137482813-137482835 GGAGACAGTGTCTCCCTCTGGGG + Intergenic
1015997906 6:139013688-139013710 CTTGACAGGGTCTCACTCTGTGG + Intergenic
1016019902 6:139226281-139226303 TGAGACAGGGTCTCACTCTGTGG - Intergenic
1016761226 6:147739576-147739598 TGAGACAGGGTCTCACTCTGTGG - Intergenic
1017469522 6:154725669-154725691 TGAGACAGAGTCTTGTTCTGTGG - Intergenic
1017488263 6:154922475-154922497 TGAGACAGGGTCTTGCTCTGTGG - Intronic
1017845438 6:158254160-158254182 GGAGACAGAGTCTTGCTCTGTGG + Intronic
1018470371 6:164091074-164091096 TGAGACGGGGTCTCGCTCTGTGG - Intergenic
1018693012 6:166364154-166364176 TGAGACAGGGTCTCACTCTGTGG - Intergenic
1018775344 6:167009478-167009500 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1019066885 6:169309802-169309824 GGAGACAGGGTCTCACTCTGTGG - Intergenic
1019489222 7:1303536-1303558 TGAGACAGGGTCTCTCTCTGTGG - Intergenic
1019734224 7:2642706-2642728 AGAGACAGGGTCTTGCTCTGTGG - Intronic
1019773031 7:2895674-2895696 AGAGACAGGGTCTCACTCTGTGG + Intergenic
1019943712 7:4310555-4310577 TCAGACAGGGTCTGGCTCTGGGG + Intergenic
1020031394 7:4935330-4935352 TGAGACAGGGTCTCACTCTGTGG - Intronic
1020126445 7:5535173-5535195 AGAGACAGGGTCTAGCTCTGTGG + Intronic
1020164245 7:5795816-5795838 ACAGGCAGGGTCTCGCTCTGTGG - Intergenic
1020258400 7:6515762-6515784 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1021237907 7:18165777-18165799 TGAGACAGGGTCTTGCTCTGTGG - Intronic
1022291150 7:29004914-29004936 TGAGACAGGGTCTCACTCTGTGG + Intronic
1022313496 7:29220248-29220270 TAAGACAGGGTCTCCCTCTGTGG - Intronic
1023422768 7:40000521-40000543 TGAGACAGAGTCTCGTTCTGTGG - Intronic
1023829380 7:44029907-44029929 TGAGACAGAGTCTTGTTCTGCGG + Intergenic
1023917338 7:44599456-44599478 TGAGACAGTGTCTTGTTCTGAGG - Intergenic
1023971350 7:44993426-44993448 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1024271981 7:47649522-47649544 TGAGACAAGGTCTTGTTCTGTGG - Intergenic
1024362139 7:48479255-48479277 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1024436905 7:49367075-49367097 CTAAACATGGTCACGTTCTGAGG + Intergenic
1024459613 7:49646875-49646897 TGAGACAGGGTCTCCCTCTGTGG + Intergenic
1024646846 7:51378073-51378095 TGAGACAGGGTCTTGCTCTGTGG + Intergenic
1025075288 7:55937278-55937300 GGAGACAGAGTCTTGCTCTGTGG - Intronic
1025085902 7:56023038-56023060 TCAGACAGGGTCTCATTCTGTGG - Intronic
1025097211 7:56105588-56105610 AGAGACAGGGTCTCATTATGTGG - Intronic
1025168349 7:56733686-56733708 AGAGACAGGGTCTCACTCTGTGG - Intergenic
1025704038 7:63846203-63846225 AGAGACAGGGTCTCACTCTGTGG + Intergenic
1025927410 7:65970867-65970889 TGAGACAGGGTCTTGCTCTGTGG - Intronic
1025944234 7:66093850-66093872 TTAGACAGAGTCTTGCTCTGTGG - Intronic
1026145300 7:67741234-67741256 GGAGACAGGATCTTGCTCTGTGG + Intergenic
1026239013 7:68555550-68555572 TTAGACAGGGTCTTGCTCTGTGG - Intergenic
1026293993 7:69035277-69035299 TGAGACAGGGTCTCACTCTGTGG + Intergenic
1026398630 7:69985775-69985797 TGAGACAGGGTCTTGCTCTGTGG + Intronic
1026559752 7:71438902-71438924 GGAGACAAGGTCTTGTTTTGTGG + Intronic
1026574173 7:71558052-71558074 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1026584266 7:71643446-71643468 TTTGACAGAGTCTCGCTCTGTGG - Intronic
1026606759 7:71823200-71823222 AGAGACAGGGTCTCACTCTGTGG + Intronic
1026835857 7:73638640-73638662 CAAGACAGGGTCTCACTCTGTGG + Intergenic
1027007273 7:74705970-74705992 GGAGACAGAGTCTCCCTCTGTGG + Intronic
1027265016 7:76489801-76489823 TGAGACAGAGTCTCGTTCTGTGG - Intronic
1027316388 7:76987904-76987926 TGAGACAGAGTCTCGTTCTGTGG - Intergenic
1027623526 7:80521465-80521487 TAAGACAGGGTCTTGCTCTGTGG + Intronic
1027670165 7:81086802-81086824 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
1028790832 7:94850971-94850993 TGAGACAGGGTCTCACTCTGTGG - Intergenic
1028820741 7:95208702-95208724 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1029046318 7:97632707-97632729 TGAGACAGAGTCTCATTCTGTGG - Intergenic
1029191669 7:98776378-98776400 AGAGACAGGGTCTTGCTCTGTGG + Intergenic
1029272294 7:99384526-99384548 TGAGACAGGGTCTCTCTCTGTGG - Intronic
1029293211 7:99518399-99518421 GGAGACAGAGTCTCGCTCTGTGG - Intronic
1029349863 7:100005541-100005563 TGAGACAGGGTCTCACTCTGTGG + Intergenic
1029371069 7:100151092-100151114 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1029409542 7:100399869-100399891 GAGTACAGGGTCTCGTTCTGGGG - Exonic
1029425483 7:100491575-100491597 TAAGACAGGGTCTCACTCTGTGG - Intronic
1029552754 7:101246336-101246358 AGAGACAGGGTCTCATTCTGTGG + Intronic
1029587343 7:101483525-101483547 AGAGACAGGGTCTTGCTCTGTGG + Intronic
1029592936 7:101519328-101519350 AGAGACAGGGTCTCGCTCTGTGG + Intronic
1029655950 7:101924583-101924605 GGAGACAGGGTCTTGCTCTGTGG + Intronic
1029667022 7:102002278-102002300 TGAGACAGGGTCTCACTCTGAGG - Intronic
1029739687 7:102484165-102484187 TGAGACAGAGTCTTGTTCTGCGG + Intronic
1029757688 7:102583344-102583366 TGAGACAGAGTCTTGTTCTGCGG + Intronic
1029775624 7:102682405-102682427 TGAGACAGAGTCTTGTTCTGCGG + Intergenic
1029929134 7:104352143-104352165 TTATACAGGGCCTCGCTCTGAGG - Intronic
1030095375 7:105894142-105894164 CAAGACAGAGTCTCGCTCTGTGG - Intronic
1030310598 7:108065091-108065113 GGAGACAGGGTCTTGCTTTGCGG + Intronic
1031048146 7:116917272-116917294 GAAGACAGAGTCTTGCTCTGTGG + Intronic
1031460637 7:122044636-122044658 GTTGACAGGGTCACGTTGAGTGG + Intronic
1031509904 7:122637211-122637233 TGAGACAGGGTCTCACTCTGTGG + Intronic
1031636827 7:124110762-124110784 GGAGACAGGGTCTCACTCTCCGG - Intergenic
1032210114 7:129905943-129905965 GGAGACAGTGTCTCGCTCAGTGG - Intronic
1032586512 7:133151948-133151970 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1032623254 7:133560302-133560324 TTAGACAGAGTCTCCGTCTGTGG + Intronic
1032727226 7:134601712-134601734 TGAGACAGGGTCTTGCTCTGTGG - Intergenic
1032964478 7:137080025-137080047 CGAGACAGGGTCTCACTCTGTGG + Intergenic
1033003436 7:137533266-137533288 TGAGACAGGGTCTCACTCTGTGG - Intronic
1033039111 7:137902172-137902194 GGAGACAGAGTCTCGCTCTGTGG - Intronic
1033197988 7:139343558-139343580 TGAGACAGGGTCTCGCTCCGTGG - Intronic
1033408103 7:141090203-141090225 AGAGACAGGGTCTCACTCTGTGG + Intronic
1033461386 7:141550477-141550499 TTAGACAGGGTCTCACTCTGTGG - Intergenic
1033503633 7:141978242-141978264 GTAGGCAGGCTCTTGTTCGGGGG + Intronic
1033612286 7:142975089-142975111 TGAGACAGAGTCTCGTTCTGTGG - Intergenic
1033784373 7:144713103-144713125 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1034063650 7:148116117-148116139 TTAGACAGAGTCTCGCTCTGTGG - Intronic
1034190257 7:149208207-149208229 TGAGACAGAGTCTCATTCTGTGG + Intronic
1034204971 7:149307476-149307498 TGAGGTAGGGTCTCGTTCTGTGG + Intergenic
1034444002 7:151102628-151102650 TGAGACAGGGTCTCGCTCTGTGG + Intronic
1034445607 7:151112616-151112638 TGAGACAGGGTCTCACTCTGTGG + Intronic
1034522975 7:151634967-151634989 TGAGACAGGGTCTCCCTCTGTGG + Intronic
1034625099 7:152486402-152486424 GGGGACAGGGTCTTGCTCTGTGG - Intergenic
1034647759 7:152663817-152663839 GGGGACAGGGTCTTGCTCTGTGG - Intronic
1034736107 7:153430869-153430891 TGAGACGGAGTCTCGTTCTGTGG - Intergenic
1035026311 7:155828784-155828806 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1035328236 7:158078865-158078887 TGAGACAGGGTCTCCCTCTGTGG + Intronic
1035407483 7:158609038-158609060 ATGGACAGGGTCTTGTTGTGTGG - Intergenic
1036457787 8:8924789-8924811 GGAGACAGAGTCTCGCTCTGTGG + Intergenic
1036531952 8:9598679-9598701 TTAGACAAGGTCTTGCTCTGTGG - Intronic
1036809029 8:11854505-11854527 TGAGACAGGGTCTTGGTCTGTGG + Intronic
1036951015 8:13139267-13139289 TGAGACAGGGTCTCACTCTGTGG - Intronic
1037068697 8:14616261-14616283 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1037394037 8:18423231-18423253 AGAGACAGGGTCTTGCTCTGTGG - Intergenic
1038309514 8:26435560-26435582 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1038378916 8:27073873-27073895 TGAGACAGGGTCTCGCTATGAGG - Intergenic
1038731780 8:30134559-30134581 GGAGACAGAGTCTCATTCTATGG + Intronic
1039054911 8:33528333-33528355 GGAGACAGAGTCTCACTCTGTGG + Intergenic
1039211142 8:35215698-35215720 TTAGACAGAGTCTCGCTCAGTGG - Intergenic
1039287137 8:36053999-36054021 TTAGACAGGGTCTTGCTCTGTGG - Intergenic
1039558025 8:38490809-38490831 TGAGACAGGGTCTCCTTCTGTGG + Intergenic
1040030312 8:42817979-42818001 AGAGACAGGGTCTCTCTCTGTGG + Intergenic
1040068618 8:43170458-43170480 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1040504056 8:48031006-48031028 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1040892278 8:52329739-52329761 TTAGACAGAGCCTCGCTCTGTGG - Intronic
1041680783 8:60588261-60588283 TGAGACAGGGTCTTGCTCTGTGG - Intronic
1042133521 8:65612434-65612456 AGGGACAGGGTCTTGTTCTGTGG - Intronic
1042212994 8:66400274-66400296 AGAGACAGGTTCTCATTCTGTGG - Intergenic
1042989488 8:74622582-74622604 TGAGACAGGGTCTCACTCTGTGG - Intronic
1043446800 8:80326998-80327020 GGAGCCAGGGTCTTGCTCTGTGG - Intergenic
1043821844 8:84876144-84876166 GAAGACATGATCTTGTTCTGAGG - Intronic
1043847695 8:85180595-85180617 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1044023097 8:87130755-87130777 TGAGACAGGATCTTGTTCTGTGG - Intronic
1044278412 8:90328556-90328578 TGAGACAGGGTCTTGCTCTGTGG - Intergenic
1044692028 8:94890610-94890632 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1044902116 8:96957851-96957873 GGAGACAGGATCTGGCTCTGTGG + Intronic
1045248281 8:100461990-100462012 GGAGACAGGGTTTTGCTCTGTGG + Intergenic
1045259950 8:100563631-100563653 TTAGACAGAGTCTTGCTCTGTGG - Intergenic
1045289286 8:100818325-100818347 TGAGACAGGGTCTCACTCTGTGG - Intergenic
1045370335 8:101516432-101516454 TGAGACAGGGTCTCCCTCTGTGG + Intronic
1045379442 8:101608808-101608830 GTAGAGAGGTCCTCTTTCTGTGG + Intronic
1045504792 8:102770778-102770800 TGAGACAGGGTCTTGCTCTGTGG + Intergenic
1045534431 8:103013766-103013788 TGGGACAGAGTCTCGTTCTGTGG - Intergenic
1045644154 8:104283925-104283947 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
1045999247 8:108399325-108399347 TGAGACAGGGTCTCCATCTGTGG - Intronic
1046252606 8:111652613-111652635 TGAAACAGGGTCTCATTCTGTGG + Intergenic
1046730249 8:117717678-117717700 TGAGACAGGGTCTCACTCTGTGG - Intergenic
1046792724 8:118339308-118339330 TAAGACAGGGTCTCACTCTGTGG - Intronic
1047204442 8:122792085-122792107 GTACACAGGATCTCTTTCTGGGG - Intronic
1047261925 8:123270764-123270786 TGAGACGGGGTCTCATTCTGTGG - Intronic
1047288158 8:123506207-123506229 TGAGACAGGGTCTCGCTCTGTGG - Intronic
1047291892 8:123539023-123539045 AGAGACAGGGTCTCGCTCTGTGG + Intronic
1047306434 8:123656714-123656736 TGAGACAGGGTCTCACTCTGTGG + Intergenic
1047315803 8:123731853-123731875 TGAGACAGGATCTCGCTCTGTGG - Intronic
1047405856 8:124585432-124585454 TAAGACAGAGTCTTGTTCTGTGG + Intronic
1047508749 8:125500094-125500116 TAAGACAGGGTCTTGCTCTGTGG - Intergenic
1048045765 8:130771220-130771242 TGAGACTGGGTCTCATTCTGTGG - Intergenic
1048361278 8:133699051-133699073 TGAGACAGGGTCTCACTCTGTGG - Intergenic
1049083934 8:140463436-140463458 TGAGACAGGGTCTTGCTCTGTGG + Intergenic
1049117260 8:140699826-140699848 GGAGACAGAGTCTTGCTCTGTGG + Intronic
1049163012 8:141109693-141109715 GGAGACAGGGTCCTGCTCTGTGG - Intergenic
1049265407 8:141665205-141665227 GGAGACAGAGTCTAGCTCTGGGG + Intergenic
1049457193 8:142699659-142699681 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
1049768928 8:144370270-144370292 AGAGACAGGGTCTCACTCTGTGG - Intergenic
1050232860 9:3546863-3546885 TGAGACAGGGTCTCACTCTGTGG - Intergenic
1050331483 9:4550408-4550430 GAAGACAGGGTCTCATTCTATGG + Intronic
1050451874 9:5790197-5790219 TGAGACGGAGTCTCGTTCTGTGG + Intronic
1050533048 9:6607560-6607582 TAAGACAGAGTCTCGCTCTGTGG - Intronic
1051141271 9:13981722-13981744 TGAGACAGGGTCTCGCTCTGTGG + Intergenic
1051253735 9:15190359-15190381 AGAGACAGGATCTCGCTCTGTGG + Intronic
1051275450 9:15393967-15393989 AGAGACAGGGTCTCAGTCTGTGG + Intergenic
1051384359 9:16491339-16491361 GTGGAAAGGGTCTCATGCTGGGG + Intronic
1051403977 9:16714059-16714081 GGAGACAAGGTGTGGTTCTGTGG - Intronic
1051656471 9:19386461-19386483 TGAGACAGGGTCTCATTGTGTGG - Intergenic
1052207881 9:25865566-25865588 TTAGACGGAGTCTCGCTCTGTGG + Intergenic
1052303657 9:26981432-26981454 TGAGACAGAGTCTTGTTCTGTGG + Intronic
1053132004 9:35620792-35620814 GGAGACAGAGTCTCACTCTGTGG - Intronic
1053506133 9:38645079-38645101 TGAGACAGGGTCTCCCTCTGCGG + Intergenic
1054785213 9:69203631-69203653 TGAGACAGGGTCTCGCTCTATGG + Intronic
1055517774 9:77050428-77050450 TTTGACAGAGTCTCGCTCTGTGG - Intergenic
1055607453 9:77985602-77985624 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1056013359 9:82355817-82355839 TGAGACAGGGTCTCACTCTGTGG + Intergenic
1056353084 9:85771670-85771692 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
1056648696 9:88438129-88438151 TGAGACAGGGTCTTGCTCTGTGG - Intronic
1056649023 9:88441734-88441756 TTAGACAGGGTCTCACTCTGTGG - Intronic
1057407852 9:94789891-94789913 TTAGACGGAGTCTCGCTCTGTGG + Intronic
1057572184 9:96213056-96213078 GGAGACAGGGTCTCACTCTGTGG + Intergenic
1057580851 9:96286668-96286690 TGAGACAGGGTCTCCCTCTGTGG - Intronic
1057782170 9:98058738-98058760 AGAGACAGGGTCTCGCTATGTGG - Intronic
1058340808 9:103893831-103893853 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1058666836 9:107326459-107326481 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1058888292 9:109339711-109339733 TTAGACAGGGTCTTGCTTTGTGG + Intergenic
1058895629 9:109398263-109398285 TTAGACCGAGTCTCATTCTGTGG - Intronic
1059482034 9:114599166-114599188 TGAGACAGGGTCTCATTCTGTGG + Intergenic
1059555667 9:115277751-115277773 TGAGACAGGGTCTCACTCTGTGG + Intronic
1060019743 9:120118768-120118790 AGAGACAGGGTCTCACTCTGTGG - Intergenic
1060184470 9:121555672-121555694 TGAGACAGGGTCTCATTATGTGG + Intergenic
1060378135 9:123137427-123137449 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1060389045 9:123263503-123263525 TGAGACAGGGTCTTGCTCTGTGG - Intronic
1060410869 9:123399383-123399405 TGAGATAGGGTCTCGCTCTGAGG + Intronic
1060511219 9:124234187-124234209 TAAGACAGGGTTTCATTCTGTGG + Intergenic
1060641691 9:125244208-125244230 TGAGACAGAGTCTCGTTCTGTGG - Intergenic
1060648095 9:125299633-125299655 GGAGACAGAGTCTCGCTCTATGG - Intronic
1061122678 9:128653694-128653716 GGAGACAGAGTCTCGCTCTGTGG - Intronic
1061171917 9:128962638-128962660 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1061190507 9:129080082-129080104 TGAGACAGGGTCTTGCTCTGAGG - Intergenic
1061309186 9:129751301-129751323 AGAGACAGGGTCTTGCTCTGTGG - Intronic
1061349043 9:130049357-130049379 TGAGACAGGGTCTCGCTCTCAGG - Intergenic
1061352792 9:130078976-130078998 TGAGACGGGGTCTCGCTCTGTGG + Intronic
1061508310 9:131045200-131045222 TGAGACAGAGTCTTGTTCTGTGG - Intronic
1061605010 9:131703183-131703205 GTAGACAGGGTCTCACTGTGTGG + Intronic
1061807320 9:133143717-133143739 TGAGACAGGGTCTTGCTCTGTGG - Intronic
1062301809 9:135877789-135877811 GGAGACAGAGTCTCGTTTTGTGG - Intronic
1062504788 9:136867527-136867549 ATAGACAGGGTCTCACTCTGTGG + Intronic
1062506313 9:136879013-136879035 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1062639787 9:137512941-137512963 TCAGACAGAGGCTCGTTCTGTGG - Intronic
1203623331 Un_KI270749v1:140614-140636 ATAGACAAGGTCCTGTTCTGTGG - Intergenic
1185472795 X:394749-394771 TGAGACCGGGTCTCGCTCTGTGG - Intergenic
1185475930 X:415613-415635 AGAGACAGGGTCTTGCTCTGTGG + Intergenic
1185527242 X:789497-789519 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
1185565317 X:1090862-1090884 TGAGACAGGGTCTCACTCTGTGG - Intergenic
1185588374 X:1257278-1257300 TTAGACGGAGTCTCGCTCTGTGG - Intergenic
1185739170 X:2516846-2516868 TGAGACAGGTTCTCGCTCTGTGG - Intergenic
1185788984 X:2914247-2914269 GGAGACAGGGTCTTGCTATGTGG + Intronic
1185790277 X:2924050-2924072 AGAGACAGGGTCTTGCTCTGTGG + Intronic
1185818588 X:3180368-3180390 TGAGACAGGGTCTCACTCTGTGG + Intergenic
1185894711 X:3847599-3847621 TGAGACAGGGTCTCACTCTGTGG + Intergenic
1185899829 X:3886024-3886046 TGAGACAGGGTCTCACTCTGTGG + Intergenic
1185904945 X:3924452-3924474 TGAGACAGGGTCTCACTCTGTGG + Intergenic
1185915052 X:4025827-4025849 AGAGACAAGGTCTCATTCTGTGG + Intergenic
1186024680 X:5296264-5296286 TGAGACAGGGTCTCGATCTGTGG - Intergenic
1186025339 X:5304726-5304748 TGAGACAGGGTCTTGCTCTGTGG + Intergenic
1186207304 X:7214066-7214088 TCAGACAGGGTCTTGCTCTGTGG - Intergenic
1186395176 X:9201080-9201102 AGAGACAGGGTCTCTCTCTGTGG + Intergenic
1186434333 X:9529914-9529936 TGAGACAGGGTCTTGCTCTGTGG - Intronic
1186474187 X:9844490-9844512 TGAGACAGGGTCTTGCTCTGTGG - Intronic
1186933222 X:14417793-14417815 GTGTACAGGGTTTCTTTCTGGGG + Intergenic
1187073898 X:15915151-15915173 TGAGACAGGGTCTCGCTCTGTGG + Intergenic
1187147935 X:16654864-16654886 TTAGACAGGGTCTCCCTCTGTGG - Intronic
1187151340 X:16684487-16684509 GGAGACAGAGTCTCGCTCTGTGG - Intronic
1187164114 X:16788620-16788642 AGAGACAGGGTCTCACTCTGCGG - Intronic
1187430865 X:19223268-19223290 TGAGACAGGGTCTCACTCTGTGG + Intergenic
1187446213 X:19363670-19363692 GGAGACAGAGTCTCACTCTGTGG + Intronic
1187673279 X:21690138-21690160 CGAGACAGGGTCTTGCTCTGTGG + Intergenic
1187881623 X:23852592-23852614 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1188479844 X:30625906-30625928 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1188766599 X:34100467-34100489 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
1189314391 X:40043864-40043886 TGAGACAGGGTCTCACTCTGTGG + Intergenic
1189438535 X:41013831-41013853 AGAGACGGTGTCTCGTTCTGTGG - Intergenic
1189495757 X:41506802-41506824 AGAGACAGGGTCTCACTCTGTGG + Intergenic
1190049529 X:47139482-47139504 TGAGACAGGGTCTCGCTCTGTGG + Intergenic
1190076334 X:47319936-47319958 GGAAACAGGGTCTCATTCTATGG - Intergenic
1190176741 X:48156736-48156758 TGAGACAGGGTCTCACTCTGTGG - Intergenic
1190223839 X:48530622-48530644 GGAGACAGGGTCTTGCTCTGTGG + Intergenic
1190237115 X:48624719-48624741 TGAGACAGGGTCTTGCTCTGTGG - Intergenic
1190835451 X:54096389-54096411 TGAGACAGAGTCTCGCTCTGTGG - Intronic
1191086521 X:56573654-56573676 AGAGACAGGGTCTCGCCCTGTGG + Intergenic
1191647813 X:63502720-63502742 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
1191778610 X:64844586-64844608 GTTGAGAAGGTCTCGTTGTGGGG - Intergenic
1192288927 X:69771075-69771097 TGAGACAGAGTCTCGCTCTGTGG + Intronic
1192443741 X:71194720-71194742 TGAGACAGAGTCTTGTTCTGTGG + Intergenic
1192790104 X:74373194-74373216 CCAGCCAGGGTCTCGCTCTGTGG - Intergenic
1193119911 X:77812660-77812682 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
1194649743 X:96500457-96500479 TGAGACAAGGTCTCGCTCTGTGG - Intergenic
1195035605 X:100968931-100968953 GGAGACAAGGTCTGGCTCTGTGG - Intergenic
1195051924 X:101104827-101104849 AGAGACAGGGTCTTGCTCTGTGG - Intronic
1195075638 X:101325195-101325217 GAAAACAGGGTCTCCCTCTGAGG - Intergenic
1195253126 X:103067410-103067432 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1195355867 X:104039709-104039731 GTACACAGAGTCTTGCTCTGTGG - Intergenic
1195616183 X:106913970-106913992 TGAGACAGGGTCTCGCTCTGTGG + Intronic
1195712478 X:107784957-107784979 TGAGACAAGGTCTCATTCTGTGG - Intronic
1196008302 X:110858375-110858397 TGAGACAGGGTCTCTCTCTGTGG - Intergenic
1196084056 X:111664849-111664871 TGAGACAGGGTCTTGCTCTGGGG - Intergenic
1196154926 X:112418126-112418148 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1196417022 X:115481983-115482005 TGAGACAGGGTCTTGCTCTGTGG - Intergenic
1196503938 X:116418657-116418679 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
1196652845 X:118186473-118186495 AGAGACAGGGTCTGGCTCTGTGG + Intergenic
1196704972 X:118709645-118709667 TGAGATAGGGTCTAGTTCTGTGG - Intergenic
1196724057 X:118880061-118880083 GGATACAGGGTTTCCTTCTGAGG - Intergenic
1197200163 X:123741787-123741809 TGAGACAGAGTCTCGCTCTGTGG - Intergenic
1197308147 X:124869211-124869233 TGAAACAGGGTCTCGCTCTGTGG - Intronic
1197519479 X:127479296-127479318 GGAGACAGAGTTTCGCTCTGTGG - Intergenic
1197666541 X:129230104-129230126 TGAGACAGGGTCTGGCTCTGTGG - Intergenic
1198240878 X:134784508-134784530 TGAGACAGGGTCTCACTCTGTGG + Intronic
1198261219 X:134966344-134966366 GGAGACAGAGTCTTGCTCTGTGG - Intergenic
1198467236 X:136914625-136914647 TGAGACAGGGTATTGTTCTGTGG + Intergenic
1198821454 X:140652445-140652467 TTAGACGGAGTCTCGCTCTGTGG - Intergenic
1198885621 X:141332911-141332933 GGAGACGGAGTCTCGCTCTGTGG - Intergenic
1199163708 X:144646279-144646301 TTAGACAGAGTCTCGCTCTGTGG + Intergenic
1199897568 X:152138529-152138551 GAAGCGAGGTTCTCGTTCTGAGG - Exonic
1199947140 X:152679176-152679198 GAAGCGAGGGTCTCGGTCTGAGG + Intergenic
1199962540 X:152789278-152789300 GAAGCGAGGGTCTCGGTCTGAGG - Intergenic
1200266482 X:154648900-154648922 AGAGACAGGGTCTTGCTCTGTGG + Intergenic
1200328553 X:155268553-155268575 TGAGACAGAGTCTCGCTCTGTGG + Intergenic
1201191259 Y:11442979-11443001 ATAGACAAGGTCCTGTTCTGTGG - Intergenic
1201275584 Y:12294827-12294849 TGAGACAGGGTCTCGCTGTGTGG - Intergenic
1201284039 Y:12363887-12363909 AGAGACAGGGTCTTGCTCTGTGG - Intergenic
1201306159 Y:12552322-12552344 ATTGACAGGGTCTCACTCTGTGG + Intergenic