ID: 1146121909

View in Genome Browser
Species Human (GRCh38)
Location 17:30203201-30203223
Sequence ACCGATAAGCTATATATGTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 57}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146121906_1146121909 -7 Left 1146121906 17:30203185-30203207 CCTGGAGTGATGATCAACCGATA 0: 1
1: 0
2: 0
3: 4
4: 24
Right 1146121909 17:30203201-30203223 ACCGATAAGCTATATATGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 57
1146121904_1146121909 7 Left 1146121904 17:30203171-30203193 CCTCTTTAAATGTCCCTGGAGTG 0: 1
1: 0
2: 1
3: 15
4: 112
Right 1146121909 17:30203201-30203223 ACCGATAAGCTATATATGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 57
1146121905_1146121909 -6 Left 1146121905 17:30203184-30203206 CCCTGGAGTGATGATCAACCGAT 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1146121909 17:30203201-30203223 ACCGATAAGCTATATATGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146121909 Original CRISPR ACCGATAAGCTATATATGTG GGG Exonic
908270570 1:62417905-62417927 ACCAATAAGCTATATCTATATGG + Intergenic
916374607 1:164138756-164138778 ATCAATTAGCTATATATGCGTGG - Intergenic
919222826 1:194653129-194653151 AATGATAAGCTTTATATTTGAGG + Intergenic
921689914 1:218136815-218136837 ACCAATCACCCATATATGTGTGG - Intergenic
924407818 1:243770103-243770125 ACCAATTAGCCATATATGTATGG + Intronic
1063912334 10:10844138-10844160 ACAGATAAGCTCTATTTGTGAGG - Intergenic
1068103348 10:52582841-52582863 ACAGATAAACTATATCAGTGAGG + Intergenic
1071254302 10:83855758-83855780 ATCAATAAGCTATATAATTGTGG + Intergenic
1071473083 10:86000616-86000638 ACCAATTGGCTATATTTGTGTGG - Intronic
1074913184 10:117930791-117930813 ACCAATATGCTATATATGTAGGG - Intergenic
1080957706 11:37119945-37119967 ATCCATATGCTTTATATGTGTGG + Intergenic
1081041366 11:38218198-38218220 ACTGATAGGATATATGTGTGTGG - Intergenic
1085585149 11:77695787-77695809 AGCGCTAAGATATATATGTATGG + Intronic
1101469145 12:104978611-104978633 ATCAATTAACTATATATGTGTGG + Intergenic
1103457556 12:121078019-121078041 ACCCATAAGCTATATAGAAGTGG - Intergenic
1111167600 13:84480609-84480631 ACCAATAAGCTAAAGATATGAGG - Intergenic
1111301559 13:86357135-86357157 ACCGATAAGAAATATTTATGTGG - Intergenic
1116189319 14:41643457-41643479 GCCGAGAAGATATGTATGTGGGG - Intronic
1119633620 14:76256293-76256315 ATCAATAGGCCATATATGTGTGG + Intergenic
1138863166 16:60784018-60784040 ATCGATTGGCAATATATGTGTGG + Intergenic
1146121909 17:30203201-30203223 ACCGATAAGCTATATATGTGGGG + Exonic
1152010801 17:77713303-77713325 ACCAATTGGCCATATATGTGTGG + Intergenic
1153901480 18:9621040-9621062 ACAGAAAAGCTATGAATGTGAGG - Intergenic
1156147483 18:34202827-34202849 TCCTACCAGCTATATATGTGTGG - Intronic
1157494534 18:48146432-48146454 ACAGAGAGGCTATATATGTTTGG + Intronic
1158619343 18:59018078-59018100 ATCGATAAGCAAAATATTTGTGG + Intergenic
1159873811 18:73788215-73788237 ACCATTAATCTATATAAGTGTGG + Intergenic
1164914420 19:32039516-32039538 ACCGATAAGGAAGCTATGTGTGG + Intergenic
932465326 2:71919150-71919172 ATCAATAAGCCATATATGTGAGG - Intergenic
937631467 2:124106751-124106773 ACTGACCAGCTATATATATGGGG - Intronic
938100752 2:128496614-128496636 ACCAATAGGATATATATATGAGG - Intergenic
939559058 2:143712400-143712422 AAGGATAAGATATATATGTTTGG + Intronic
940440094 2:153704940-153704962 ACAGTTAAGCTAGAAATGTGGGG + Intergenic
944090259 2:195901165-195901187 ACAGAAAAAGTATATATGTGAGG + Intronic
1174309962 20:49644708-49644730 AGGGAAAACCTATATATGTGTGG + Intronic
1174812289 20:53656873-53656895 ACCACTAAACTATGTATGTGTGG - Intergenic
1181556250 22:23673359-23673381 ACCTCTCAGCTATATATATGGGG - Intergenic
950266936 3:11580877-11580899 ACTTATAAGCTACATATTTGTGG + Intronic
955630652 3:60970370-60970392 AACTATAAGCTAACTATGTGAGG - Intronic
958031203 3:88113254-88113276 ACCAATAAGCTATATTTAGGGGG - Intronic
964709260 3:159654503-159654525 ACTGATAATATATATAAGTGGGG - Intronic
979917767 4:126458648-126458670 AACGAAAAGCTACATGTGTGGGG + Intergenic
988068633 5:26257321-26257343 ACAGAAAAGGTACATATGTGAGG - Intergenic
1003253054 6:4449280-4449302 AAAGATAAACTATATATGTGTGG + Intergenic
1009310480 6:62145879-62145901 ACCTTTAAGCTATATGTGTAAGG + Intronic
1010769583 6:79812892-79812914 ATCATTAAGGTATATATGTGGGG - Intergenic
1014995161 6:128134103-128134125 AGCAATAAACTATATTTGTGAGG + Intronic
1017803926 6:157926453-157926475 ACAGATAACCTAAATATTTGAGG + Intronic
1018852516 6:167651266-167651288 ACCGAGAAGCTATGTGTGTGAGG + Intergenic
1020933145 7:14426356-14426378 ACCCTTAAGCTTTATTTGTGAGG + Intronic
1023662942 7:42489284-42489306 ATATATATGCTATATATGTGAGG + Intergenic
1030567772 7:111181530-111181552 AACTAGTAGCTATATATGTGGGG - Intronic
1031683027 7:124697769-124697791 ACTTATATGCTATATATCTGGGG + Intergenic
1043125866 8:76394011-76394033 ACCCATAAGATAAATATATGTGG + Intergenic
1046214977 8:111132376-111132398 ATCGATTAACTGTATATGTGTGG - Intergenic
1051954224 9:22670539-22670561 ACCGAGAAGCATTTTATGTGAGG - Intergenic
1052983441 9:34466625-34466647 AGGGAGAAGGTATATATGTGGGG + Intronic
1057940466 9:99278263-99278285 ACCGACAAGCAATTTATGAGAGG + Intergenic
1058499450 9:105595825-105595847 ATCTATAAGCTATAGATGGGAGG - Intronic
1058572497 9:106362075-106362097 ACCAGTTGGCTATATATGTGTGG + Intergenic
1196015231 X:110932251-110932273 ATCAGTAATCTATATATGTGTGG - Intergenic
1196075052 X:111567113-111567135 GCCGATAATGTATATAGGTGTGG - Intergenic
1198436795 X:136625120-136625142 ACTAATACGCTATATATATGTGG + Intergenic