ID: 1146124050

View in Genome Browser
Species Human (GRCh38)
Location 17:30218186-30218208
Sequence GGTGCAGTTGCCAGTGTTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146124047_1146124050 7 Left 1146124047 17:30218156-30218178 CCAGGTGATGTTGTCCTCGGAGA 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1146124050 17:30218186-30218208 GGTGCAGTTGCCAGTGTTCCAGG 0: 1
1: 0
2: 2
3: 12
4: 167
1146124049_1146124050 -7 Left 1146124049 17:30218170-30218192 CCTCGGAGAAGTAATTGGTGCAG 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1146124050 17:30218186-30218208 GGTGCAGTTGCCAGTGTTCCAGG 0: 1
1: 0
2: 2
3: 12
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146124050 Original CRISPR GGTGCAGTTGCCAGTGTTCC AGG Exonic
900196953 1:1381323-1381345 GCTCCAGTTGCCAGAGCTCCAGG + Intergenic
900640469 1:3685861-3685883 GCTGCAGGTGGCAGTTTTCCAGG - Intronic
900666767 1:3820802-3820824 GGTGCAGGTGCCACTGTGCTGGG + Intronic
900718714 1:4161406-4161428 GGTGCTGTTGTCCGGGTTCCGGG + Intergenic
901424612 1:9173958-9173980 GGTGCAGTGGCCACTGCTTCTGG + Intergenic
902333280 1:15741332-15741354 TGTGCAGTAGCAGGTGTTCCTGG - Exonic
904263267 1:29303458-29303480 CTGGGAGTTGCCAGTGTTCCAGG + Intronic
905024452 1:34840136-34840158 GGGGCAGTTGCCAGTGTCTTTGG + Intronic
907213369 1:52842322-52842344 GGTGCTGTTGCCAGATTTTCAGG + Intergenic
909190257 1:72541399-72541421 GGTGCAGTTGCCAGCCCTTCAGG - Intergenic
912586078 1:110767206-110767228 GGTAGAGATGCCAGTGTTCAGGG - Intergenic
916562051 1:165941621-165941643 GCTGCACCTCCCAGTGTTCCTGG - Intergenic
918670950 1:187216119-187216141 TGTACAGTTTCCAGTGTTTCAGG - Intergenic
920008115 1:202848193-202848215 GGTGCAAGTGCCAGTCCTCCTGG + Intergenic
921368043 1:214393377-214393399 GGTGCAGTTCCCAATTTGCCAGG - Intronic
922020802 1:221702483-221702505 GGGGCAGTTGCTAGAGTTCGAGG - Exonic
923049356 1:230379935-230379957 GGTGCAGGAGCCAGACTTCCTGG - Intronic
924197647 1:241624729-241624751 GAAGCAGTTACCAGTGTTCCTGG + Intronic
924798237 1:247308514-247308536 GCTGCAGGTGCCAGAGTTCCAGG - Exonic
924843703 1:247743372-247743394 AGTGCTGTTGCCAGTGGTCTGGG + Intergenic
1064938566 10:20707427-20707449 GGTGCAGGGCACAGTGTTCCAGG + Intergenic
1070658260 10:78285993-78286015 GGATCACTTGCTAGTGTTCCAGG + Intergenic
1070799032 10:79234208-79234230 GGTGCAGTTGCCAGGATGCCAGG + Intronic
1072331431 10:94357248-94357270 GGTGCAGTTTGCAGAGTTCTTGG + Exonic
1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG + Exonic
1073899487 10:108203713-108203735 AGTGCTGTTGCCAGTGGTCTGGG - Intergenic
1074693945 10:116030777-116030799 GGGGCAGTTGGCAGGGATCCAGG + Intergenic
1075065101 10:119283945-119283967 TGTGCAGTTACCACAGTTCCTGG - Intronic
1075415507 10:122259351-122259373 GGAGCAATTGCCAGTGAGCCAGG - Intergenic
1076037579 10:127213704-127213726 GCTGCCGTGGCCAGCGTTCCAGG + Intronic
1076784916 10:132745063-132745085 GGTGCATTTGCCTCTGCTCCAGG + Intronic
1082687586 11:56259682-56259704 GCTGCAGCAGCCAGTGTGCCTGG - Intergenic
1083938252 11:65881570-65881592 GGTCCAGCTGCCAGTGTCCCTGG - Intronic
1083985749 11:66214090-66214112 GGTGCAGCTCCCTGTGTGCCAGG + Intronic
1085497006 11:76978929-76978951 GCTGCAGTAGCCAGTGTGCCTGG + Intronic
1085517005 11:77117426-77117448 GGGGCAGATGGCAGTGGTCCTGG + Intronic
1086585163 11:88443043-88443065 GGTGCAGTCTCCAGTCCTCCTGG + Intergenic
1086605552 11:88692040-88692062 TGTGCAGCTTCCAGTGTTTCTGG - Intronic
1087897633 11:103604641-103604663 GATGCATTTCCCAGGGTTCCCGG - Intergenic
1090560469 11:127926856-127926878 GGTGCATTTACCACTGTCCCAGG - Intergenic
1097080091 12:56423624-56423646 GGAGGAGTTGCAAGTGGTCCAGG - Exonic
1101576241 12:105999594-105999616 TGTGCACTGGACAGTGTTCCTGG - Intergenic
1102195281 12:111021150-111021172 GGTGCTCCTGCCAGTCTTCCTGG - Intergenic
1102430353 12:112878244-112878266 GGAGCAGTAGCCAGTGTTCCAGG - Intronic
1102458893 12:113087881-113087903 GGGTCAGTTGTCAGTGTTTCGGG + Intronic
1104312248 12:127663892-127663914 GGTGAAGAGGGCAGTGTTCCAGG - Intergenic
1110047116 13:70844614-70844636 GCTGCAGTAGCCATTGTGCCTGG - Intergenic
1111091662 13:83453886-83453908 ACTGCAGCTGCCAGTGTGCCTGG + Intergenic
1111202706 13:84961283-84961305 GCTGCAGCAGCCAGTGTGCCTGG - Intergenic
1113833269 13:113313515-113313537 TGTGGAGATGCCAGTGTGCCTGG + Intronic
1113833529 13:113314475-113314497 TGTGGAGATGCCAGTGTGCCTGG + Intronic
1113833628 13:113314859-113314881 TGTGGAGATGCCAGTGTGCCTGG + Intronic
1113833653 13:113314955-113314977 TGTGGAGATGCCAGTGTGCCTGG + Intronic
1114653824 14:24303959-24303981 GGTGGAGGTGGCAGTGTTCTGGG + Intronic
1116467872 14:45254036-45254058 GGTGCGGTTGCCTGTAATCCTGG - Intergenic
1117490388 14:56241055-56241077 GGTCCAGTTTCCAGTGTTCCAGG - Intronic
1119944186 14:78674358-78674380 GGTGCATTGGCCAGGGATCCAGG - Intronic
1122076422 14:99237963-99237985 TGAGCAGTTGCCCATGTTCCTGG - Intronic
1122544537 14:102514894-102514916 GGTGCAGGTGCCAGTCTTAAAGG - Intergenic
1124507740 15:30293190-30293212 GGTGCTGGTGCAAGTGGTCCAGG + Intergenic
1124735816 15:32245468-32245490 GGTGCTGGTGCAAGTGGTCCAGG - Intergenic
1130901814 15:88212929-88212951 GGTGCAGTGACCAGCTTTCCTGG - Intronic
1131063349 15:89417838-89417860 GGAGCAGATGCCCTTGTTCCTGG + Intergenic
1131624714 15:94105071-94105093 GGTGCAGTTAAGAGTTTTCCAGG - Intergenic
1132185112 15:99797200-99797222 GGTGCTGGTGCCTGTCTTCCCGG - Intergenic
1133221982 16:4322796-4322818 GGTGCCGTTCCCAGTGGACCTGG + Intronic
1133728882 16:8561112-8561134 GTTGCAGTTCCCAGAATTCCAGG - Intergenic
1134829702 16:17313213-17313235 TGTGAAGTTGCCAGGGCTCCAGG - Intronic
1136401147 16:30019685-30019707 GGAGCAGTTGCCTGTGGGCCTGG + Intronic
1138189644 16:55003896-55003918 GGTGCGGTTGCCTCTGTTACGGG + Intergenic
1138492270 16:57383461-57383483 GCTGCAGTTGCCAGTCACCCCGG + Exonic
1139472906 16:67187697-67187719 CCTGGAGTTGCCAGTCTTCCAGG - Exonic
1139945125 16:70635590-70635612 GGAGCTGTTTCCAGTGTTCAAGG + Intronic
1141443660 16:84044925-84044947 GGTGCATGAGCCAGTGCTCCCGG + Intergenic
1142225249 16:88873997-88874019 GGTGCACATGCCACTGTCCCTGG + Intergenic
1145263291 17:21367245-21367267 GCTGCTGCTGCCACTGTTCCCGG - Intergenic
1146124050 17:30218186-30218208 GGTGCAGTTGCCAGTGTTCCAGG + Exonic
1147340486 17:39750732-39750754 GGTGTGGGTGCCAGAGTTCCAGG + Intergenic
1147767873 17:42849147-42849169 GGCGCTGTAGCCAGTGCTCCGGG - Exonic
1150060478 17:62065037-62065059 GGTCCAGATGCCCGAGTTCCCGG - Intronic
1150166727 17:62951042-62951064 GGTGGAGTGGGCGGTGTTCCTGG - Intergenic
1150692209 17:67376859-67376881 GCTGCACTTCCCAGTTTTCCAGG + Intergenic
1151454308 17:74216927-74216949 GTAGCAGTTTCCAGTGTGCCAGG - Intronic
1152146624 17:78572459-78572481 GGTGCAGGTGCCAGAGCCCCAGG + Intronic
1152322901 17:79618256-79618278 GGGGCAGTGGCCAGTGTCTCCGG + Intergenic
1152927251 17:83092894-83092916 GGTGCAGGTGCCTTTGGTCCAGG + Intronic
1157404147 18:47409579-47409601 GGTGCAGCTTCCAGTGTGCTTGG + Intergenic
1158183509 18:54744982-54745004 AGCCCACTTGCCAGTGTTCCTGG - Intronic
1158734523 18:60064467-60064489 GGCACAATTGCCAGTGTGCCTGG + Intergenic
1158839032 18:61364013-61364035 GGTGCAGTTCCAAGTGTATCTGG - Intronic
1159565471 18:70043007-70043029 GGTGCAGTTTCCTGTCATCCTGG - Intronic
1160059938 18:75520257-75520279 GGTGGAGGTGGCTGTGTTCCTGG + Intergenic
1160083642 18:75754074-75754096 GGTGCTGTTGCCACTCTTCCAGG - Intergenic
1161167172 19:2794545-2794567 GGTGCTGTTGCCTGTGTCCTTGG - Intronic
1167489953 19:49786839-49786861 GGTGCAGATGACATTGTCCCTGG + Intronic
1168180408 19:54658840-54658862 GGAGCAGTTGCAATTGATCCTGG + Intronic
925577783 2:5378476-5378498 GGTGCAGTTGCCAGTCATTTTGG - Intergenic
925673309 2:6334431-6334453 GATGTAATTTCCAGTGTTCCTGG - Intergenic
926886566 2:17604042-17604064 GCTGCAGTTGCCAGTTTTGAAGG - Intronic
928012993 2:27628572-27628594 GGTGCAGTCTCCAGGGTTGCTGG - Exonic
931535560 2:63271747-63271769 GGTGCAGGTGCTAGTGTTGGTGG - Intronic
935237204 2:101149619-101149641 GGTGCATTTAGCAGGGTTCCTGG - Intronic
938962379 2:136355014-136355036 TGTGCATTTGTCAATGTTCCTGG - Intergenic
939857093 2:147371650-147371672 GGTGCAGTTGTCAGTGTGCTTGG - Intergenic
940575830 2:155503156-155503178 AGTGCAGTTGCCAGTGATCTGGG - Intergenic
941575095 2:167220129-167220151 GTTGCATTTGCCAATTTTCCTGG - Intronic
942500463 2:176584609-176584631 GAAGCATTTGCCAGTGTTCAAGG + Intergenic
944501490 2:200364803-200364825 GGACCAGTTGCCAGTCATCCCGG + Intronic
946277804 2:218644025-218644047 GGTGCAGATGGTAGTGATCCAGG - Exonic
947059298 2:226144636-226144658 GGAGCTGTTTCCAGTGTGCCAGG - Intergenic
947987951 2:234465055-234465077 GTTGCAGGTGCCAGTTTGCCTGG + Intergenic
1170768533 20:19312295-19312317 GGCGCAGGGGACAGTGTTCCAGG + Intronic
1170853007 20:20021005-20021027 GGTGCAGATGCCTGTGTGCGTGG + Intronic
1171941246 20:31331853-31331875 TATATAGTTGCCAGTGTTCCTGG - Intergenic
1176306332 21:5125312-5125334 GGTGCAGAAGCCAGGGTCCCAGG + Intronic
1177248447 21:18561805-18561827 TCTGCAGTTGCCTGAGTTCCTGG + Intergenic
1179098408 21:38335827-38335849 GGTGGCTTTGCCAGTGTTCATGG + Intergenic
1179850726 21:44136718-44136740 GGTGCAGAAGCCAGGGTCCCAGG - Intronic
1182869408 22:33633096-33633118 TTTAGAGTTGCCAGTGTTCCAGG + Intronic
1183303337 22:37069310-37069332 GGTGCTGTGGACCGTGTTCCTGG - Exonic
1183381536 22:37492713-37492735 GGTGCTGTTGCCTGAGTGCCTGG - Exonic
1184935005 22:47714634-47714656 GGAGCAGTAGTTAGTGTTCCTGG + Intergenic
1185398376 22:50603884-50603906 GGCGCAGTCGCCAGTGCGCCCGG + Exonic
950534127 3:13569591-13569613 GATGCATTTGCCAGTGCTACTGG + Intronic
953741240 3:45541112-45541134 GCTGCAGTGGCCAGTGCTCCAGG - Intronic
954614386 3:51962135-51962157 GGTACAGTAGAAAGTGTTCCAGG - Intronic
957392374 3:79593417-79593439 GCTGGTGTTGCCAGTGTTCTAGG + Intronic
961060866 3:123826860-123826882 GGTGCATTTGCCTGGGTTCTAGG - Intronic
961752871 3:129107634-129107656 GCTGCAAGTGCCAGTGTCCCTGG + Intronic
962079034 3:132117606-132117628 AGTGCTGTTGCCAGTGGTCCAGG - Intronic
968998507 4:3961513-3961535 TGTGCAGTAATCAGTGTTCCGGG + Intergenic
970855345 4:20644711-20644733 GGTTCTGATGCCAGTGGTCCAGG - Intergenic
976432070 4:84973866-84973888 GGTCCAGTAGCCAGTGTTAAAGG - Intergenic
976469870 4:85416001-85416023 AGTGCAGGTGTCTGTGTTCCTGG + Intergenic
976899066 4:90151148-90151170 GGTACATTTGAAAGTGTTCCAGG - Intronic
978325794 4:107552703-107552725 GGGGCTGCTGCCAGTTTTCCAGG + Intergenic
978476534 4:109137514-109137536 GGGGTTGTTGCCAGTGGTCCAGG - Intronic
980685254 4:136219573-136219595 AGTGCTGTGGCCAGTGTACCAGG - Intergenic
985933122 5:3074563-3074585 GGTGCTTCTCCCAGTGTTCCAGG + Intergenic
986749370 5:10772808-10772830 GGTGCAGATGCTACTGCTCCAGG - Intergenic
987713457 5:21534263-21534285 GACACTGTTGCCAGTGTTCCTGG + Intergenic
991183586 5:63782803-63782825 GGAGCAGATGCCAGGGTACCTGG - Intergenic
996008191 5:118449320-118449342 TGAGCAGCTGCCAGTATTCCTGG + Intergenic
999139928 5:149353518-149353540 GGTGCACTTGCCTGTGGTCCTGG - Exonic
1001925246 5:175631349-175631371 GGTGTAGCTGCCAGGGTCCCAGG - Intergenic
1002543078 5:179919267-179919289 GGTGCAGTGGCCAGCATCCCAGG - Intronic
1003549113 6:7086030-7086052 GGAGCACTTGGCAGGGTTCCAGG + Intergenic
1003832830 6:10033369-10033391 GGAGCTGTTGCAAGAGTTCCTGG + Intronic
1004247158 6:13990009-13990031 GGAGCAGTTGCCAGGCTTCATGG + Intergenic
1007490084 6:42213988-42214010 TGTGCATTTGCCAGTATTCTAGG + Intronic
1009823621 6:68838106-68838128 GTAGCAGTTGGCAGAGTTCCTGG - Intronic
1014544598 6:122718800-122718822 GGTAAAGTTGCAAATGTTCCTGG + Intronic
1017700455 6:157064620-157064642 GGTGCATTTGGAAGTGTTCTCGG - Intronic
1019127001 6:169847265-169847287 AGTGCCGTTGCTAGTCTTCCTGG + Intergenic
1019145462 6:169972884-169972906 TCTGCACTTGCCAGTGATCCTGG + Intergenic
1019547797 7:1586819-1586841 GGTGCAGTGGCTCTTGTTCCTGG + Intergenic
1022853002 7:34284098-34284120 GGTGCTGTTGCCTCTCTTCCAGG - Intergenic
1030225600 7:107146842-107146864 GATACAGCTGCCAGTGTTCAGGG - Intronic
1032876567 7:136044820-136044842 GATGCAGTTGCCAGTGCTCATGG - Intergenic
1033686730 7:143647145-143647167 GGGGCAGTGGCCAGGGTTCTGGG + Intronic
1033689004 7:143720162-143720184 GGGGCAGTGGCCAGGGTTCTGGG - Exonic
1033697879 7:143810469-143810491 GGGGCAGTGGCCAGGGTTCTGGG - Intergenic
1034491568 7:151395805-151395827 GGAGCAGCTGCGGGTGTTCCGGG - Exonic
1038604217 8:28982498-28982520 AGTGCAGTGGCCAGTGATCATGG + Intronic
1040789204 8:51205634-51205656 AGTGCTGTTGCCAGTGGTCTGGG - Intergenic
1041840489 8:62264812-62264834 GGTGCATGTGCCACTGCTCCTGG + Intronic
1047807246 8:128373303-128373325 GGTGCTGTTGCCACTGGTGCTGG + Intergenic
1047807270 8:128373516-128373538 GGTGCTGGTGCCAGTGGTGCTGG + Intergenic
1047807292 8:128373696-128373718 GGTGCAGTTGCTGGTGCTGCTGG + Intergenic
1050734296 9:8745929-8745951 GTGGCACTTGCCAGTATTCCCGG - Intronic
1051333174 9:16043901-16043923 GTTGCAGTTACCCTTGTTCCAGG + Intronic
1052820177 9:33132248-33132270 CGGGCAGTTCCTAGTGTTCCAGG + Intronic
1053150257 9:35738717-35738739 CATGCAGTGGCCAGTGTGCCAGG - Intronic
1056563864 9:87757239-87757261 GGTGCAGATCCCAGTGTCCAGGG + Intergenic
1059901214 9:118928259-118928281 GGTCCCGTGGCCAGTGTTTCAGG + Intergenic
1062345942 9:136115351-136115373 GGCGCAGATGCCTGTGTTCAGGG - Exonic
1186127414 X:6429054-6429076 GGTACAATTGCCTCTGTTCCTGG - Intergenic
1189117609 X:38359156-38359178 GGTATACTTGCCAGTTTTCCAGG + Intronic
1191765082 X:64689564-64689586 GGTGCATTTGCCTGTAGTCCTGG + Intergenic
1192277539 X:69648759-69648781 GATGGACTTGCCAGTGATCCTGG + Intronic
1192771991 X:74202884-74202906 CGTGCAGGTGACAGTGTTGCAGG + Intergenic
1200076700 X:153554759-153554781 GGAGAAGTTGCCAGTGCCCCCGG - Intronic