ID: 1146124050

View in Genome Browser
Species Human (GRCh38)
Location 17:30218186-30218208
Sequence GGTGCAGTTGCCAGTGTTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146124047_1146124050 7 Left 1146124047 17:30218156-30218178 CCAGGTGATGTTGTCCTCGGAGA 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1146124050 17:30218186-30218208 GGTGCAGTTGCCAGTGTTCCAGG 0: 1
1: 0
2: 2
3: 12
4: 167
1146124049_1146124050 -7 Left 1146124049 17:30218170-30218192 CCTCGGAGAAGTAATTGGTGCAG 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1146124050 17:30218186-30218208 GGTGCAGTTGCCAGTGTTCCAGG 0: 1
1: 0
2: 2
3: 12
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146124050 Original CRISPR GGTGCAGTTGCCAGTGTTCC AGG Exonic