ID: 1146124104

View in Genome Browser
Species Human (GRCh38)
Location 17:30218461-30218483
Sequence CTGGAGTCCTTGGAATGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 260}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146124104_1146124111 -4 Left 1146124104 17:30218461-30218483 CCATTCCATTCCAAGGACTCCAG 0: 1
1: 0
2: 1
3: 35
4: 260
Right 1146124111 17:30218480-30218502 CCAGGCCACCGTGGGAAAAGTGG 0: 1
1: 0
2: 0
3: 21
4: 202
1146124104_1146124117 30 Left 1146124104 17:30218461-30218483 CCATTCCATTCCAAGGACTCCAG 0: 1
1: 0
2: 1
3: 35
4: 260
Right 1146124117 17:30218514-30218536 GTCACTCATATGTATTTGCAAGG 0: 1
1: 0
2: 2
3: 10
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146124104 Original CRISPR CTGGAGTCCTTGGAATGGAA TGG (reversed) Intronic
901798890 1:11695882-11695904 CTGGAGGCCTTTGAATGGGTGGG + Intronic
901870873 1:12138520-12138542 CTGGAGACCCTGGAGTTGAAAGG + Intronic
903569618 1:24294706-24294728 CTGGAGCTCTTGGAAGGAAAGGG + Intergenic
903793935 1:25914089-25914111 CTGGAGTCCTGGGTATTGAGAGG - Intergenic
903806709 1:26010843-26010865 CTAGCTTCCTTGGAAAGGAACGG + Intergenic
904001828 1:27343126-27343148 CTGGAGCCGTGGCAATGGAAGGG + Intronic
904498603 1:30901466-30901488 CTGGAGTTCCAGGAGTGGAAGGG + Intronic
905577636 1:39058432-39058454 CTGGAGTGCATGGAGTGCAATGG - Intergenic
905705900 1:40057474-40057496 CTGCAGGCCAAGGAATGGAAAGG + Intronic
906360284 1:45151038-45151060 CTGGACTCCTTGGAGTGACAGGG - Intronic
906610291 1:47196917-47196939 CTGGAGCCCTGGGTAGGGAAAGG - Intergenic
907628957 1:56060836-56060858 CTGGGGTCCTTGGAAGGCAGAGG - Intergenic
907987745 1:59549205-59549227 CTGGAGTTCCTGGAGAGGAAGGG - Intronic
908149103 1:61281430-61281452 CTGGGAGCCTTGGAGTGGAAGGG + Intronic
908325219 1:63017067-63017089 ATGGAGTCCAGGGAGTGGAATGG - Intergenic
908825825 1:68131826-68131848 CTGGTGTCCTTTGAAAGAAAAGG + Intronic
911070178 1:93826116-93826138 CTGGAGTCCTTACCATGGCAGGG - Intronic
911540341 1:99150246-99150268 CTGGATTTCCTGGAATGGAATGG + Intergenic
914827737 1:151147247-151147269 CTGGAGGCCTGGGAAAGGAAAGG + Intergenic
915442047 1:155951363-155951385 CTGGAGAGCTTGGATTGGGAGGG + Intronic
915622103 1:157092239-157092261 CTGGAGACCTTAGCCTGGAATGG + Exonic
916444762 1:164862022-164862044 CTGGAGGCCTTGGAATGTTTGGG + Intronic
918582268 1:186145413-186145435 CTGGAGTCCTTGGAGTGGCTGGG + Exonic
919307101 1:195856040-195856062 CTAGAGTTCTGGGAATGGAGCGG - Intergenic
919698099 1:200600293-200600315 CTGGAATCATAGGAATGGCAGGG - Intronic
919869965 1:201812746-201812768 CTGGAGTCTTCGGCATGTAAAGG + Intronic
924168505 1:241310944-241310966 CTGGAGTTGGTGGAATGCAATGG + Intronic
1062821263 10:536261-536283 CTGGTGTCCTTGGAGAGGAAAGG - Intronic
1063639543 10:7816477-7816499 CAGCTGTCCTTGGAATTGAATGG + Intergenic
1064232304 10:13539870-13539892 TTAGAGTACTGGGAATGGAATGG + Intergenic
1064727575 10:18297169-18297191 TAGAAGTGCTTGGAATGGAATGG - Intronic
1064753236 10:18553297-18553319 CTCCATTCCATGGAATGGAATGG + Intronic
1066022480 10:31318532-31318554 CAGGCGTCCCTGGAAGGGAAGGG + Intronic
1066737463 10:38492285-38492307 ATGGAATGCCTGGAATGGAACGG + Intergenic
1066740785 10:38517315-38517337 ATGGACTCAATGGAATGGAATGG + Intergenic
1066743425 10:38580518-38580540 ATGGACTCGATGGAATGGAATGG + Intergenic
1067481543 10:46602648-46602670 CTGGAGTCAAAGGAAAGGAAGGG + Intergenic
1067613209 10:47739081-47739103 CTGGAGTCAAAGGAAAGGAAGGG - Intergenic
1069953162 10:72033542-72033564 CTGGAGTGCCTGGGAGGGAACGG - Intergenic
1071981784 10:91010666-91010688 AAGGAGTGCCTGGAATGGAAAGG - Intergenic
1073938295 10:108661751-108661773 CTGGCTTTCTTTGAATGGAAAGG + Intergenic
1074479939 10:113810034-113810056 CTGGAGTACATGGCAGGGAATGG + Intergenic
1075084380 10:119404802-119404824 GTGCAGTCCTAGGAATGGAAGGG - Intronic
1075088723 10:119431070-119431092 CTGTTGCCCTGGGAATGGAACGG + Intronic
1075104795 10:119531827-119531849 CAGGAGACCATGGAATGGAAGGG - Intronic
1077772318 11:5233543-5233565 CTGTAGTAAATGGAATGGAAAGG - Intronic
1077882247 11:6360302-6360324 CCAGAGTCCTTGGACTGGCAGGG + Intergenic
1078657823 11:13258766-13258788 CTGGAGCCATGAGAATGGAAAGG + Intergenic
1079454210 11:20623093-20623115 TTGCAGTGCTAGGAATGGAAGGG - Intronic
1082064446 11:47887994-47888016 ATGGAGTACTAGGAAAGGAATGG + Intergenic
1084166016 11:67375046-67375068 CTGGTGCCCCTGGAATGGGAGGG + Intronic
1084718484 11:70889191-70889213 CTGGAGTCCGTATAAGGGAAAGG + Intronic
1085318339 11:75559536-75559558 CTGGAGACTTTGGAAGGGCAGGG - Intergenic
1085901342 11:80703390-80703412 ATGGAGTCCTGGGAAAGGCAAGG + Intergenic
1086441633 11:86834602-86834624 CCGGAGTCATAGGAAAGGAAAGG - Intronic
1088948780 11:114543314-114543336 CTGGAGTGCATGGAATACAATGG - Intronic
1089619726 11:119715207-119715229 CTGGAGTCTTAGCATTGGAAGGG - Intronic
1089776957 11:120844526-120844548 CTGGAGTTCTTGGGGTAGAAGGG + Intronic
1089778508 11:120856474-120856496 CTGGAGGGGTTGGAAAGGAAGGG + Intronic
1089904951 11:122029039-122029061 CTGGGGTCCTAGAAAAGGAAAGG + Intergenic
1091186261 11:133650351-133650373 ATGGAGTCCATGGACTTGAAAGG + Intergenic
1094233985 12:28142219-28142241 CAGGATTCCTAGTAATGGAATGG - Intronic
1095102094 12:38195955-38195977 ATGGAGTGCTTGGACTGGCAGGG - Intergenic
1095238999 12:39834641-39834663 CCCCACTCCTTGGAATGGAAAGG - Intronic
1096421797 12:51464987-51465009 AAGGAGTCCTTGCAATGGAAGGG + Intronic
1096559404 12:52424830-52424852 CTGGAGTCCTTGGGTGGGGAGGG + Intronic
1096791044 12:54045146-54045168 ATGGAGTCCTAGGAATGAAGAGG - Intronic
1097299685 12:58004892-58004914 TTGAAGTCCTTGGTATGGACAGG + Intergenic
1100431447 12:94535004-94535026 CAGGAGTTCATGGAAGGGAAGGG - Intergenic
1100557372 12:95709247-95709269 ATGGAGTCCTTGGTAGGGAAAGG + Intronic
1100897244 12:99197357-99197379 CTGGAGTTCTTGGGAGGGAATGG - Intronic
1101759688 12:107648516-107648538 CTGGTGTCCCTTGAATGGAATGG - Intronic
1101965824 12:109281370-109281392 ATGGAGTGATGGGAATGGAATGG - Intronic
1104851142 12:131874669-131874691 CTGGGGTCATCGGAAAGGAAAGG - Intergenic
1105480160 13:20767743-20767765 TTGGAGTCCCTGAAAGGGAAGGG - Intronic
1106636039 13:31529197-31529219 CTGGAGTCCTTGCACTGGTTGGG + Intergenic
1106933847 13:34696607-34696629 CTGGAGTGCTGGGAATAGAGTGG - Intergenic
1108114875 13:47116296-47116318 CAAGAGGCCTTGGAATAGAAAGG + Intergenic
1108335048 13:49431766-49431788 GTGAATTCCTGGGAATGGAATGG - Intronic
1109172971 13:59118413-59118435 CTGAAGTGCTGGGAAGGGAAGGG - Intergenic
1112294330 13:98173437-98173459 CTGGAGTCTTTGGAATCCTAGGG + Intronic
1113446070 13:110368179-110368201 CTGGAGTCCTTAGAACAGAGTGG - Intronic
1114656863 14:24321374-24321396 CTGGAGTGCATGTAATGGCACGG - Intronic
1116173793 14:41438252-41438274 CTTGGGTCCTTGGAGTGTAATGG + Intergenic
1116859223 14:49980442-49980464 GAGGAGTCCTGGGAAGGGAATGG - Intergenic
1117087897 14:52220346-52220368 CTGGAGTGCATGGAATGCAGTGG + Intergenic
1117991454 14:61437944-61437966 CTAGAGTTCTAGGAATAGAAAGG - Intronic
1119697741 14:76726910-76726932 CAGGAGTGCTGGGAAGGGAAGGG - Intergenic
1121393433 14:93596239-93596261 CAGGAGTTCATGGGATGGAAAGG + Intronic
1121656702 14:95602314-95602336 TTGGAGTCATTGGCATGTAATGG + Intergenic
1122108355 14:99478292-99478314 CCGAAGTCCTGGGAATGGAGTGG - Intronic
1122354838 14:101116632-101116654 TTGGAGTGCTTGGAGTGGGAAGG - Intergenic
1202874095 14_GL000225v1_random:192214-192236 ATGGAGTCGATGGAATGGAATGG + Intergenic
1124644975 15:31432220-31432242 CTGGAGCTCTTGCACTGGAAAGG + Intronic
1126324746 15:47464477-47464499 CAGGAGTCCTTGGCATGGACTGG - Intronic
1127362261 15:58254639-58254661 CTGGTGTCCTTGTAAAAGAAAGG - Intronic
1129741320 15:77991004-77991026 CTGGATTCCTTGGACTGGCAGGG - Intronic
1129844344 15:78761395-78761417 CTGGATTCCTTAGACTGGCAGGG + Intronic
1130257455 15:82332384-82332406 CTGGATTCCTTAGACTGGCAGGG - Intergenic
1130597489 15:85257581-85257603 CTGGATTCCTTAGACTGGCAGGG + Intergenic
1130666252 15:85872265-85872287 CTGGAATGCCTGGAATGGAGGGG + Intergenic
1132039620 15:98514071-98514093 CTGAAGTCCTTGCAAAGGCACGG + Intronic
1135344314 16:21675485-21675507 CTGGAGTCCCAGGAAAGGAGGGG - Intergenic
1136268543 16:29134594-29134616 CTGGAGTCCTCGGAAAGCTAAGG + Intergenic
1136624974 16:31456833-31456855 CTGGGGAACTTGGAAGGGAAGGG + Intergenic
1136903659 16:34066334-34066356 CTGGATTAAATGGAATGGAATGG + Intergenic
1136904239 16:34072158-34072180 CTGGATTAAATGGAATGGAATGG + Intergenic
1137558844 16:49490184-49490206 CTGGAGTCCTGGCAAGGGAAGGG + Exonic
1138833017 16:60398718-60398740 CTGTAGTCTTTGAAATGGAGAGG - Intergenic
1139212252 16:65090863-65090885 CTGGAGTGTTTGGAAAAGAATGG - Intronic
1139221189 16:65184159-65184181 CTGGAGTCTTTGGAGTATAAGGG - Intergenic
1139261460 16:65598677-65598699 CTGGGGAGCTTGGCATGGAAGGG - Intergenic
1139670609 16:68490556-68490578 CTAGATCCCTTGGAAGGGAACGG - Intergenic
1140046437 16:71442877-71442899 CTGGAGCCCTGGGCCTGGAAGGG - Intergenic
1140242080 16:73211816-73211838 CAGGAGTCTTGGGGATGGAATGG + Intergenic
1140310157 16:73841039-73841061 CTGGAGTCCTGGAAGTGGAGAGG + Intergenic
1140689944 16:77472387-77472409 CTGGAGGACAGGGAATGGAAAGG - Intergenic
1141064287 16:80901393-80901415 CTGGTATCCTTGGAAGGAAAGGG + Intergenic
1141651452 16:85395200-85395222 CTGAATCCCTGGGAATGGAATGG + Intergenic
1142026421 16:87816562-87816584 CTGGAGCCCCAGGAGTGGAAGGG - Intergenic
1142049266 16:87947359-87947381 CTGGAGTGCTGGAAAAGGAATGG - Intergenic
1142071855 16:88094936-88094958 CTGGAGTCCTCGGAAAGCTAAGG + Intronic
1142109271 16:88322654-88322676 CTGGAGTCCGTGGGATGGAGGGG - Intergenic
1143416914 17:6757039-6757061 CTGGAGTGCCTGGAGTGCAATGG + Intronic
1143681504 17:8479484-8479506 CTGGAGTCCAAAGAATGGAGTGG + Intronic
1145333817 17:21895304-21895326 ATGGACTAGTTGGAATGGAATGG + Intergenic
1145695933 17:26787834-26787856 ATGGACTCGATGGAATGGAACGG + Intergenic
1145700278 17:26824358-26824380 ATGGACTCGATGGAATGGAATGG + Intergenic
1146124104 17:30218461-30218483 CTGGAGTCCTTGGAATGGAATGG - Intronic
1146650526 17:34603499-34603521 CTGCAGTCCCTGGAATGGCATGG - Intronic
1151766336 17:76135268-76135290 CTGGGGTCCATGGAGAGGAAGGG + Intergenic
1152215119 17:79027518-79027540 CTGGGGTCCTTGGCCTGGAAGGG + Intronic
1152367174 17:79863038-79863060 CTGGAGTGCTAGGAGGGGAAGGG + Intergenic
1203178753 17_KI270729v1_random:39668-39690 ATGGACTCACTGGAATGGAATGG + Intergenic
1203180262 17_KI270729v1_random:51109-51131 ATGGACTCAATGGAATGGAATGG + Intergenic
1153447938 18:5195443-5195465 CTCCCCTCCTTGGAATGGAAAGG + Intronic
1155165141 18:23226046-23226068 CTGGAGTCCTAAGAAGGAAAGGG + Intronic
1155813656 18:30274157-30274179 CTGGATTCCTTTCAATGAAAGGG + Intergenic
1156939737 18:42752881-42752903 CTGGAGGCCTTAGAAAGCAATGG + Intronic
1159606918 18:70484380-70484402 CTGGTGTCCCTGAAAAGGAAGGG - Intergenic
1160740302 19:682520-682542 CTGGAGTTCTTGGGCTGGCAGGG - Exonic
1163144844 19:15373302-15373324 CTGGAGTCATAGGACTCGAACGG + Exonic
1167678682 19:50906299-50906321 CTGGAATCTCTTGAATGGAAGGG + Intergenic
1167703750 19:51066106-51066128 CTGGAGTACTTGGTATGGTTAGG - Intergenic
1168443913 19:56395577-56395599 ATGGATTCCATGGAATGGAGAGG - Intergenic
925336966 2:3105882-3105904 CTGGTGTCCTTAGAAGAGAAGGG - Intergenic
926021216 2:9497113-9497135 CTGGAGTCCTGTGCATGTAATGG - Exonic
926521790 2:13924400-13924422 GTGGAGTCCTTGGAATAACAGGG - Intergenic
927923145 2:26989383-26989405 CCGGAGTCCGTGCAATGCAAGGG + Intronic
928461078 2:31473209-31473231 CTAGTGTACCTGGAATGGAATGG + Intergenic
928729311 2:34212310-34212332 ATGTAGTCCTTGGAAAGTAAAGG + Intergenic
928871596 2:35987368-35987390 CATGAATCCTTGAAATGGAATGG + Intergenic
932093734 2:68828819-68828841 ATGGAGTCCTTTCCATGGAAGGG - Intergenic
932722639 2:74148746-74148768 ATGGAGTCATGAGAATGGAAGGG + Intergenic
934083738 2:88491830-88491852 CTGGAATCCTTAGAATTAAATGG + Intergenic
935134920 2:100291563-100291585 TTGGAGTCATTTTAATGGAACGG - Intronic
936412203 2:112270404-112270426 CTGGAGTCTAAGGATTGGAAAGG + Intergenic
936507399 2:113118294-113118316 ATGGAGTCCTTGGAGTGTGAGGG + Intronic
936621943 2:114109237-114109259 CTGGAGTGCTTGGCCTGGAGTGG + Intergenic
936626293 2:114152943-114152965 GTGGAGTCCTTTGAAAGGACTGG + Intergenic
937112646 2:119378449-119378471 GTGGAGTCCTTGGAAAGGACTGG + Intergenic
938760854 2:134424562-134424584 CTGGAGTCATTCCTATGGAAGGG + Intronic
948653166 2:239461806-239461828 TTGGAGTCCCCGGAATGGCAGGG - Intergenic
1169886060 20:10399057-10399079 CTGGTGTCCTTGCAAGAGAAAGG + Intergenic
1171034016 20:21702392-21702414 CTGGAGTCCTTGAAATGCATGGG + Intergenic
1171305223 20:24099524-24099546 CTGGAGTGCATGGAATGGCAAGG - Intergenic
1171520117 20:25769356-25769378 CTGGAGGCCCAGGAATGTAAGGG - Intronic
1171556802 20:26087137-26087159 CTGGAGGCCCAGGAATGTAAGGG + Intergenic
1171741079 20:28889502-28889524 ATGGAGTGGATGGAATGGAATGG - Intergenic
1171776616 20:29374159-29374181 ATGGAGTGCTTGGACTGGCAGGG + Intergenic
1171900225 20:30849641-30849663 ATGGGGTGCTTGGACTGGAAGGG - Intergenic
1171920074 20:31091413-31091435 ATGGAATGATTGGAATGGAATGG + Intergenic
1171928572 20:31209572-31209594 ATGGAATGATTGGAATGGAATGG + Intergenic
1173277489 20:41597417-41597439 CTTGAGTCCTGAGAAAGGAAAGG - Intronic
1173614419 20:44393459-44393481 CTGGCATCCCTGGAAGGGAAGGG + Intronic
1174854305 20:54028540-54028562 CTGGAGTCCTTGGGCTTGGAGGG + Exonic
1176654252 21:9575642-9575664 CTGGAGGCCCAGGAATGTAAGGG - Intergenic
1176755276 21:10721223-10721245 ATGGAGTGAGTGGAATGGAATGG - Intergenic
1177414957 21:20781130-20781152 CTGGGGCCCTTGGAAGGGGAGGG + Intergenic
1177682478 21:24390603-24390625 CTGGAGTCCTTGGAAATGGCAGG - Intergenic
1180284009 22:10727488-10727510 ATGGACTCGATGGAATGGAATGG - Intergenic
1180333590 22:11555636-11555658 ATGGGGTGCTTGGACTGGAAGGG - Intergenic
1180530707 22:16347783-16347805 ATGGATTGATTGGAATGGAATGG + Intergenic
1180532541 22:16361054-16361076 ATGGACTCGATGGAATGGAATGG + Intergenic
1180906176 22:19413543-19413565 CTGCTTTCCTTGGGATGGAAAGG - Intronic
1203291221 22_KI270735v1_random:41081-41103 ATGGAGTGTATGGAATGGAATGG - Intergenic
1203298482 22_KI270736v1_random:60600-60622 GTGGAGTCAATGGAATAGAATGG + Intergenic
1203311020 22_KI270736v1_random:142851-142873 ATGGAGTGTATGGAATGGAAAGG + Intergenic
1203317103 22_KI270737v1_random:24742-24764 ATGGACTCGATGGAATGGAATGG - Intergenic
1203318940 22_KI270737v1_random:38029-38051 ATGGATTGATTGGAATGGAATGG - Intergenic
949962818 3:9328373-9328395 GTGGAGTCCTTGGAAGAGCAGGG + Intronic
953298101 3:41742095-41742117 CTGGAGGACTGGGAAGGGAAGGG - Intronic
953852226 3:46473067-46473089 CTCCAGACCATGGAATGGAAAGG - Intronic
953862934 3:46560880-46560902 TGGGAGTCCTTGGACTGGAGAGG - Intronic
956088666 3:65640450-65640472 AAGGAGTCATTGGAATGGAAAGG - Intronic
957123969 3:76133848-76133870 CTGGAGTCAGTGGATGGGAAAGG - Intronic
958017371 3:87955546-87955568 GTAAAGTCCTTGCAATGGAATGG + Intergenic
959244983 3:103854566-103854588 GTGGAGGGCTTGGGATGGAAAGG + Intergenic
961009034 3:123423875-123423897 CTGATGTCCTTGGAGTGGCAGGG + Intronic
961323861 3:126098256-126098278 CTGGAGTCCTTAGAAGAGATGGG + Intronic
962806580 3:138931690-138931712 CTGGAGACCCTGGAAAAGAAGGG + Intergenic
962834857 3:139181135-139181157 CTGGAGTCCTTGGGAAGTATGGG + Intronic
963183872 3:142391467-142391489 CTGGAGTACTTGGAATTACAAGG - Intronic
964953779 3:162327310-162327332 CTGGGGTCATCGGAAAGGAAAGG + Intergenic
966654748 3:182343057-182343079 CTGGAGAACTTGGATTTGAATGG + Intergenic
967154722 3:186681896-186681918 CTGGAGTCCCTGGAGAAGAAGGG - Intergenic
968549548 4:1215028-1215050 GTGGACTTCTTGGAATGAAATGG - Intronic
972687094 4:41361573-41361595 CTGCAGTCCTTGGGATGGAGAGG - Intronic
973358685 4:49148295-49148317 GTGGAATCTATGGAATGGAACGG - Intergenic
973402566 4:49647258-49647280 ATGGAATGCATGGAATGGAATGG + Intergenic
974910977 4:68119525-68119547 CTAGAATTTTTGGAATGGAAAGG - Intronic
978784017 4:112589267-112589289 CTAGAGTCCTAGGAATGCAAGGG + Intronic
979275196 4:118807674-118807696 CTGGAGTGGATGGAATGGGAGGG - Intronic
980089377 4:128426283-128426305 ATGGAGTCCTAGAACTGGAAGGG + Intergenic
980872448 4:138625528-138625550 CTGGGGTCATCGGAAAGGAAAGG - Intergenic
983830981 4:172328505-172328527 CTGGCCTCCTTGAAAGGGAAGGG - Intronic
987372247 5:17203894-17203916 CTTGAGTCCTTGAAAAGGCAAGG - Intronic
987384109 5:17312579-17312601 CTGAAGTCTTTGGAATGCGATGG + Intergenic
989650740 5:43687068-43687090 ATGGAGTCCTTGCAATAGAGTGG + Intronic
989800659 5:45534354-45534376 CTGGAATGCATGGAATGCAATGG - Intronic
990319644 5:54617187-54617209 CTGGAGCCCATGGAAAGGAGAGG - Intergenic
990803251 5:59629370-59629392 CTGGTGTCCTTGTAATAAAAGGG + Intronic
990854344 5:60247106-60247128 GTTGTGACCTTGGAATGGAAAGG - Intronic
997022084 5:130013710-130013732 CTGGAGGCCTGGGAAGGAAAAGG - Intronic
998840922 5:146253035-146253057 CTGGAGTGCTTGGAGTGCAATGG + Intronic
1000049425 5:157549033-157549055 ATGGAGCCCATGGATTGGAAGGG - Intronic
1000313882 5:160070522-160070544 CTGCAGTGCTTGTGATGGAAGGG - Intronic
1002421526 5:179151749-179151771 CTGAGGTCCTGGGGATGGAAAGG + Intronic
1003255822 6:4474158-4474180 CTGCAGTCCAGGGAATGGATGGG - Intergenic
1003778155 6:9392461-9392483 CTGGAGCCCTTGGAGTGGATAGG - Intergenic
1005348106 6:24910121-24910143 CAGGAGTCCGTGGCATGGGAGGG - Intronic
1007371675 6:41430279-41430301 CTGGAGTCTTAGGATTGAAATGG - Intergenic
1007762541 6:44141474-44141496 CTGGACTCCTTGGAATCCACTGG - Intronic
1008001464 6:46364793-46364815 CTGGAGTCCTTGGCATGCCAAGG + Intronic
1010917001 6:81632449-81632471 CTCCAGTCCTTGGAAAGGAAAGG + Intronic
1013062088 6:106644558-106644580 CTGGAGTGCTTGGAGTGCAATGG + Intronic
1015074522 6:129139529-129139551 CTCAAGTCCTTGAAATGAAATGG - Intronic
1015595350 6:134861118-134861140 CTGGAGTCCAAGGAATGAGAAGG + Intergenic
1015620881 6:135130374-135130396 CTGGACTCGTTGCATTGGAAGGG + Intergenic
1016110605 6:140218907-140218929 ATGGAGGCCTTGCTATGGAAGGG + Intergenic
1022456755 7:30564580-30564602 CAGGAGTCCTAGGAAGGAAATGG - Intergenic
1022983317 7:35625149-35625171 CTGGAGCCGTTAAAATGGAAGGG + Intergenic
1023021946 7:36018915-36018937 CTAGAGTCCTTGCAAAGGAGAGG + Intergenic
1023368608 7:39489882-39489904 CTGGAGCCCTTCGATTGGAATGG - Intronic
1025280605 7:57624310-57624332 CTGGAGGCCCAGGAATGTAAGGG - Intergenic
1025304125 7:57841197-57841219 CTGGAGGCCCAGGAATGTAAGGG + Intergenic
1027344363 7:77242029-77242051 CTTGATTCCTTAGAATGGAATGG + Intronic
1030128220 7:106175091-106175113 ATGGATTACTTGGAAAGGAAAGG - Intergenic
1031589615 7:123573567-123573589 CTGGAGTGTTTGGGATGGCAGGG - Intronic
1031870960 7:127089934-127089956 CTGGAGCCCTTAGATTGGGATGG - Intronic
1032544907 7:132733950-132733972 CAGGAGTGCTGGGAAGGGAAGGG + Intergenic
1033085634 7:138339133-138339155 CTGGAGTCCTTGGCTGGGGATGG - Intergenic
1033850466 7:145488576-145488598 CTGAAGGCCTTGGAATGAATGGG - Intergenic
1034631178 7:152531661-152531683 CTGTAGTCCTAGCAATGGCAAGG - Intergenic
1037563436 8:20095638-20095660 CTGTATACCTAGGAATGGAATGG + Intergenic
1037579976 8:20239323-20239345 CTGGAGTCCCTGGAATTGACTGG - Intergenic
1037787908 8:21913213-21913235 CCGGACACCTTGGAAGGGAATGG - Intronic
1038066114 8:23965396-23965418 GTGGAGTTCCTGGAATGGAGTGG + Intergenic
1044053359 8:87537688-87537710 CTGGAGTTCATTGAATGGAATGG + Intronic
1044087435 8:87957785-87957807 CTGGAGAGCTTGGAATGGAATGG - Intergenic
1045483615 8:102612756-102612778 CTGGTATCCTAGGAATGGCATGG + Intergenic
1046360332 8:113145131-113145153 GTGGGGTGCTTGGAATGGAGTGG + Intronic
1048775322 8:137939469-137939491 GTGCAGTCAGTGGAATGGAAAGG + Intergenic
1049358850 8:142202313-142202335 CTGGAGGCCTGGGCATGGGAGGG - Intergenic
1049444750 8:142624791-142624813 CTGGAGGTTTTGGAAAGGAAAGG - Intergenic
1051623761 9:19078746-19078768 CTGGAGTGCATGGAGTGCAATGG - Intronic
1051809873 9:21036769-21036791 ATGGAGGCCTGGGGATGGAAAGG - Intergenic
1052103945 9:24488142-24488164 GTGGCATCCTTGGAATGCAATGG + Intergenic
1052130075 9:24833376-24833398 CTGGAGACATTTGAATGTAAGGG + Intergenic
1053104233 9:35396744-35396766 CTGGGGTCCTCGGGATGGCAGGG - Intronic
1053833117 9:42105427-42105449 CAGGGGTCCTTGGGTTGGAAAGG - Intronic
1054597435 9:67081982-67082004 CAGGGGTCCTTGGGTTGGAAAGG + Intergenic
1055535843 9:77243448-77243470 CTTGAGTTCTTAGAAAGGAAGGG - Intronic
1056177151 9:84045925-84045947 CTGGAGCCCTTGCAAAGGCATGG - Intergenic
1056267572 9:84914826-84914848 CTGGAGACTTTGGAATGACATGG - Intronic
1059220982 9:112618434-112618456 CTCGAGTACTTGGAGTGGATGGG + Intronic
1059299310 9:113299297-113299319 CTGGAGTCCCTGGTCTGGAAAGG + Exonic
1060148545 9:121271796-121271818 CTGGATTCCCTGAAATGGAGGGG - Intronic
1060411347 9:123402521-123402543 CTGAAGTCCTTTGGGTGGAAAGG - Intronic
1203722685 Un_GL000216v2:25128-25150 GTGGAATGATTGGAATGGAATGG - Intergenic
1203726547 Un_GL000216v2:54334-54356 TTGAAGTGTTTGGAATGGAATGG - Intergenic
1203730339 Un_GL000216v2:84159-84181 ATGGAGTCGATGGAATGGAATGG - Intergenic
1203387102 Un_KI270438v1:65987-66009 GTGGAGTGCGTGGAATGGAATGG + Intergenic
1203350634 Un_KI270442v1:78564-78586 ATGGAATGATTGGAATGGAATGG + Intergenic
1203416636 Un_KI270591v1:5633-5655 ATGGAGTGGATGGAATGGAATGG - Intergenic
1186072999 X:5843149-5843171 CTGGAGTCTATGCAATTGAAGGG + Intronic
1188309856 X:28602971-28602993 CTGTAATTCTTGGAGTGGAAAGG - Intronic
1189259752 X:39669944-39669966 CTGGAGTCCCTGTAGTGGGATGG - Intergenic
1192173958 X:68874454-68874476 CTGGGGGCCTGGGAAGGGAAGGG + Intergenic
1194885949 X:99316440-99316462 TTTGAGTCCTAGGAATGCAATGG - Intergenic
1195096845 X:101510469-101510491 CTGAGGTACTTGGAGTGGAAGGG + Intronic
1199097396 X:143758846-143758868 CTGTAGTCCCTGGAATGGTGGGG + Intergenic
1199996127 X:153027996-153028018 CTTGAGGCCCTGGAATGGGAAGG - Intergenic
1201097413 Y:10631970-10631992 ATGGATTGATTGGAATGGAATGG - Intergenic
1201104303 Y:10752124-10752146 ATGGAATCAATGGAATGGAATGG - Intergenic
1201208633 Y:11656961-11656983 GTGAACTCCTTGGAATTGAATGG + Intergenic
1201578071 Y:15481588-15481610 TTGGAGTCAGTGGAAAGGAATGG + Intergenic