ID: 1146126538

View in Genome Browser
Species Human (GRCh38)
Location 17:30235827-30235849
Sequence GAGCGCGGAGCCGCGGCCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 6, 3: 33, 4: 280}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146126538_1146126544 -10 Left 1146126538 17:30235827-30235849 CCCGCGGCCGCGGCTCCGCGCTC 0: 1
1: 0
2: 6
3: 33
4: 280
Right 1146126544 17:30235840-30235862 CTCCGCGCTCCCGCTGGATGGGG 0: 1
1: 0
2: 1
3: 12
4: 66
1146126538_1146126552 10 Left 1146126538 17:30235827-30235849 CCCGCGGCCGCGGCTCCGCGCTC 0: 1
1: 0
2: 6
3: 33
4: 280
Right 1146126552 17:30235860-30235882 GGGTTGCGCTCGCCAGGGAGGGG 0: 1
1: 0
2: 0
3: 4
4: 104
1146126538_1146126551 9 Left 1146126538 17:30235827-30235849 CCCGCGGCCGCGGCTCCGCGCTC 0: 1
1: 0
2: 6
3: 33
4: 280
Right 1146126551 17:30235859-30235881 GGGGTTGCGCTCGCCAGGGAGGG 0: 1
1: 0
2: 2
3: 9
4: 112
1146126538_1146126549 5 Left 1146126538 17:30235827-30235849 CCCGCGGCCGCGGCTCCGCGCTC 0: 1
1: 0
2: 6
3: 33
4: 280
Right 1146126549 17:30235855-30235877 GGATGGGGTTGCGCTCGCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 90
1146126538_1146126550 8 Left 1146126538 17:30235827-30235849 CCCGCGGCCGCGGCTCCGCGCTC 0: 1
1: 0
2: 6
3: 33
4: 280
Right 1146126550 17:30235858-30235880 TGGGGTTGCGCTCGCCAGGGAGG 0: 1
1: 0
2: 0
3: 27
4: 243
1146126538_1146126555 22 Left 1146126538 17:30235827-30235849 CCCGCGGCCGCGGCTCCGCGCTC 0: 1
1: 0
2: 6
3: 33
4: 280
Right 1146126555 17:30235872-30235894 CCAGGGAGGGGCCGCGCTACGGG 0: 1
1: 0
2: 0
3: 11
4: 160
1146126538_1146126557 26 Left 1146126538 17:30235827-30235849 CCCGCGGCCGCGGCTCCGCGCTC 0: 1
1: 0
2: 6
3: 33
4: 280
Right 1146126557 17:30235876-30235898 GGAGGGGCCGCGCTACGGGGCGG 0: 1
1: 0
2: 0
3: 17
4: 162
1146126538_1146126553 21 Left 1146126538 17:30235827-30235849 CCCGCGGCCGCGGCTCCGCGCTC 0: 1
1: 0
2: 6
3: 33
4: 280
Right 1146126553 17:30235871-30235893 GCCAGGGAGGGGCCGCGCTACGG 0: 1
1: 0
2: 0
3: 19
4: 217
1146126538_1146126556 23 Left 1146126538 17:30235827-30235849 CCCGCGGCCGCGGCTCCGCGCTC 0: 1
1: 0
2: 6
3: 33
4: 280
Right 1146126556 17:30235873-30235895 CAGGGAGGGGCCGCGCTACGGGG 0: 1
1: 0
2: 1
3: 5
4: 139
1146126538_1146126559 28 Left 1146126538 17:30235827-30235849 CCCGCGGCCGCGGCTCCGCGCTC 0: 1
1: 0
2: 6
3: 33
4: 280
Right 1146126559 17:30235878-30235900 AGGGGCCGCGCTACGGGGCGGGG 0: 1
1: 0
2: 1
3: 19
4: 154
1146126538_1146126548 4 Left 1146126538 17:30235827-30235849 CCCGCGGCCGCGGCTCCGCGCTC 0: 1
1: 0
2: 6
3: 33
4: 280
Right 1146126548 17:30235854-30235876 TGGATGGGGTTGCGCTCGCCAGG 0: 1
1: 0
2: 1
3: 0
4: 73
1146126538_1146126558 27 Left 1146126538 17:30235827-30235849 CCCGCGGCCGCGGCTCCGCGCTC 0: 1
1: 0
2: 6
3: 33
4: 280
Right 1146126558 17:30235877-30235899 GAGGGGCCGCGCTACGGGGCGGG 0: 1
1: 0
2: 0
3: 10
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146126538 Original CRISPR GAGCGCGGAGCCGCGGCCGC GGG (reversed) Exonic
900087228 1:904415-904437 GAGGGCGGGGCCGGGGCCGGCGG - Intergenic
900654131 1:3746858-3746880 GAGCGGGGAGCTGCGGTCCCTGG + Intergenic
900988675 1:6087548-6087570 GAGCACGGGGCCGTGGCTGCTGG - Intronic
901066613 1:6497392-6497414 GGCCGCAGAGCCGCCGCCGCCGG + Intronic
901109848 1:6785669-6785691 GAGCGCGGGGGCGCGGCGGGCGG + Intronic
901506222 1:9687613-9687635 GAGGGCGGAGCCCGGGCCGGGGG - Intronic
902067465 1:13700206-13700228 GATGGCGGCGGCGCGGCCGCGGG + Intronic
902793384 1:18784417-18784439 GGGCTCGGCGCCGCGGCCGACGG + Intergenic
903212986 1:21829041-21829063 GAGCGCCGAGCCGCTGGCCCTGG - Exonic
903420945 1:23217486-23217508 GAGCGCGGAGAAGGAGCCGCAGG - Intergenic
903492950 1:23743433-23743455 GAGGGCGGAGCTGCGGCCCGAGG + Exonic
903925180 1:26826774-26826796 GGGCGCGGAGCCGAGGCCCGCGG + Exonic
905518369 1:38578663-38578685 TAGCGCGCAGCCGAGGGCGCGGG - Intergenic
907038326 1:51236333-51236355 GACGCCGGAGCCACGGCCGCGGG - Exonic
907905673 1:58782513-58782535 GCGCGCTGAGCAGCGGCGGCGGG - Exonic
909170012 1:72282875-72282897 GAGGGAGGAGGCGCGGCGGCGGG + Intergenic
911073114 1:93847515-93847537 GAGCGCGGGGCCGTCGCCTCTGG + Intergenic
912305253 1:108560303-108560325 GTGCGCGGGGGCGCGGCCGGGGG - Exonic
912433624 1:109643409-109643431 GAGAGCAGAGCAGCGCCCGCGGG + Intergenic
912800184 1:112715319-112715341 GGGGGCGGGGCCGCGGCCGAGGG - Exonic
913942057 1:125118729-125118751 GGGCAAGGAGCCGCGGCAGCGGG - Intergenic
915319992 1:155051320-155051342 GCGCGCGGAGGAGCGGCCGGCGG - Exonic
916069013 1:161159395-161159417 GATCGCGGAGCCGTGGGGGCGGG + Intergenic
916091923 1:161314335-161314357 GAGGGCGGAGGCGCGCCGGCTGG - Exonic
917869590 1:179229606-179229628 GGGCGCGGAGCCGCGACAGGAGG - Intronic
919878725 1:201888814-201888836 CTGCGCGGAGCCGCGCCGGCTGG + Exonic
920394168 1:205631818-205631840 GCGCCAGGAGCCGCGGCGGCGGG - Exonic
920805705 1:209231808-209231830 GACCGCGGGGCCGGGGTCGCGGG + Intergenic
921204961 1:212840903-212840925 GAGCGCGGAGCCGGGTGCGGTGG - Intronic
922586410 1:226737555-226737577 GCGCGCGGAGCCGCGGCTGCCGG - Exonic
924436591 1:244048654-244048676 GAGCGCGGAGCCGCCGGGCCGGG - Intergenic
924729288 1:246697139-246697161 GAGCGTGGCCCAGCGGCCGCAGG + Intergenic
1063357243 10:5412727-5412749 GACCGCGGAGGCGAAGCCGCCGG + Exonic
1064645167 10:17453568-17453590 GCGCGCGGTACCGCGGTCGCCGG + Exonic
1064712318 10:18140400-18140422 GGGATCGGAGCCGCGGGCGCCGG - Intergenic
1067079701 10:43206019-43206041 GAGCGTGGAGGCGGGGCCGGTGG - Exonic
1067362416 10:45594709-45594731 CCGCGCGCAGCCGCCGCCGCTGG - Intronic
1070257642 10:74825554-74825576 GAGCGCGGCGCTGCGGACCCGGG + Intergenic
1072670566 10:97426224-97426246 GAGCGCGCAGGCGCGGCCGACGG + Exonic
1072757389 10:98030249-98030271 GCGCGCGGAGCCTCCCCCGCGGG - Intronic
1073032192 10:100535797-100535819 GAACGCGGAGCCGAGGCCTGAGG - Intronic
1073465605 10:103693102-103693124 GAGCGCGGGGCTGCAGCTGCAGG + Intronic
1073578054 10:104641463-104641485 GGCCGCGAAGCCGGGGCCGCCGG - Exonic
1073812437 10:107164961-107164983 GCGCCGGGACCCGCGGCCGCGGG - Intergenic
1076825338 10:132964450-132964472 GAGCGCAGGGAGGCGGCCGCAGG - Intergenic
1076916346 10:133424574-133424596 GAGCGCGGAGCCGCGGCGCCTGG + Intergenic
1076936453 10:133569369-133569391 GAGCGCGGAGCCGCGGCGCCTGG + Intronic
1078771753 11:14358582-14358604 GAGCGCGACGCTGCGGCCGCAGG + Intronic
1080037264 11:27722534-27722556 GAGAGCGGAGCCGCGGGCCAAGG + Intergenic
1080385120 11:31806256-31806278 GAGCGGGGAGCAGCCGCCGCAGG + Intronic
1081863543 11:46347586-46347608 GCGTGCTGAGCCCCGGCCGCCGG + Intronic
1083454758 11:62771373-62771395 GAGGGCGGGGCCGGGGCCCCGGG + Exonic
1084020544 11:66414761-66414783 GACCGCGGAGCCATGGACGCAGG + Intergenic
1085043971 11:73342954-73342976 GAGCGCTGCGGCCCGGCCGCCGG - Intronic
1085266550 11:75241010-75241032 GAGCGCGGCGGCCCGGGCGCTGG + Exonic
1086590481 11:88509178-88509200 GAGCGCGGCCGCGCGGGCGCCGG + Exonic
1090699313 11:129279631-129279653 AGGCGCGCCGCCGCGGCCGCGGG + Intergenic
1091916574 12:4274674-4274696 CAGCGCGGAGTCGCGACCACAGG - Intronic
1094040235 12:26114364-26114386 GAGGGCGGAGCCGAGGCGGCCGG - Intergenic
1096536630 12:52279146-52279168 GAGCGCGTAGCCGCCGCCAGGGG - Intronic
1097491001 12:60270068-60270090 GCGCGCGGAGCAGCGCCCGTCGG - Intergenic
1098897961 12:76084453-76084475 GAGCCGGGAGTCGGGGCCGCTGG - Intronic
1100611551 12:96194965-96194987 GGGAGGGGAGCCGCGGGCGCAGG - Intronic
1101371714 12:104137574-104137596 GGGCGCGGGGCCGGGGCGGCCGG - Intronic
1103749840 12:123151076-123151098 GCGCGGGCAGCAGCGGCCGCTGG - Intergenic
1104049498 12:125186290-125186312 GAGGGCGGGGCCGCGGCCGGGGG - Intergenic
1104854298 12:131894888-131894910 GGGCGCGGGGCCGGGGGCGCGGG - Exonic
1104863889 12:131941419-131941441 GAGCGCCGAGACGCTGCAGCAGG + Exonic
1104865326 12:131950103-131950125 GGTCGCGTAGCCGCAGCCGCGGG + Intronic
1104929195 12:132329355-132329377 GCGCGCCGGGCCACGGCCGCCGG + Intergenic
1105454251 13:20525806-20525828 GGACGCGGCGCCGCGGGCGCTGG + Exonic
1106197283 13:27504728-27504750 AAGCCCAGAGCCGCTGCCGCAGG + Intergenic
1107787046 13:43968350-43968372 GCGTGCTGAGCCCCGGCCGCCGG + Intergenic
1110573065 13:77026937-77026959 GCGCGGGGGGCCGCGGCTGCGGG - Exonic
1112692984 13:101916926-101916948 GAGAGCGGGACCGCGGCTGCGGG + Intronic
1113379302 13:109787266-109787288 GCTCGCGAACCCGCGGCCGCGGG - Intergenic
1117315167 14:54566211-54566233 GCGCCCGGAGCGCCGGCCGCGGG - Intergenic
1117424496 14:55580457-55580479 GGGCGGGGGGGCGCGGCCGCGGG + Intronic
1119330137 14:73787302-73787324 GCGCGCGGAGCCGGGGGCGCGGG - Intronic
1119475263 14:74923186-74923208 GAGCTGGGAGCCGGGTCCGCGGG + Intronic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1119701997 14:76761854-76761876 GAGCGGCGGGCTGCGGCCGCGGG - Intergenic
1119786879 14:77320807-77320829 GAGCGCGGGGCCCCGGGCTCGGG + Exonic
1120167880 14:81220308-81220330 GAGCGCCGGGCGGCGGGCGCGGG - Intronic
1121074925 14:91060230-91060252 GGGCGCGGGGCCGCAGCCGTGGG - Intronic
1121250193 14:92493626-92493648 TAGCGCTGAGTCGCGGCCCCTGG + Exonic
1121617024 14:95320008-95320030 GAGCGCGGGGCGGCGGGTGCGGG + Intergenic
1122418215 14:101560494-101560516 GGGCGCGGGGCAGCGGGCGCGGG - Intergenic
1122531635 14:102431955-102431977 GAGCCCGGAGCCGCTGTCGGTGG - Exonic
1122717281 14:103703244-103703266 CAGTGCGCAGCCGCGGCTGCTGG + Exonic
1123014707 14:105368152-105368174 GGGCGCGGAGCCCCGGCCCCAGG - Intronic
1124121694 15:26893884-26893906 GCGCGCGGGGCGGCGGCAGCCGG + Intronic
1125051179 15:35299500-35299522 CAGCGCGGAGCCGGGGAGGCAGG + Intronic
1125329181 15:38565174-38565196 GTGCTCCGAGCAGCGGCCGCAGG - Intronic
1128067776 15:64775358-64775380 GAGCGCGGCGCCGGCCCCGCGGG + Exonic
1130224554 15:82046979-82047001 GAGCGCCGCGCCGCCACCGCGGG + Intergenic
1130348017 15:83066898-83066920 GGTCGCGGCGCCGCCGCCGCTGG - Exonic
1131431766 15:92393988-92394010 GAGGGCGCAGCGGCGGACGCCGG - Exonic
1131799346 15:96053384-96053406 CAGCGGGGAGCCGCTGGCGCTGG + Intergenic
1131972251 15:97904331-97904353 GTGCGCGGAGGCGCCGCCTCGGG - Intergenic
1132365351 15:101252392-101252414 GAGCGCGGGGCCGGGAGCGCGGG - Intergenic
1132498593 16:275103-275125 GAGCGCGGGGCCGCGGAAGCGGG + Intronic
1132807656 16:1782501-1782523 GAGCGCGCAGCGGGGGCTGCAGG - Exonic
1132889487 16:2196760-2196782 GAGGGCGGAGCCACGGGCCCGGG - Intergenic
1134134107 16:11668477-11668499 GCGGGCGGAGCCGGGCCCGCGGG + Exonic
1136398647 16:30006193-30006215 GAGGACAGAGCCCCGGCCGCAGG + Exonic
1136609420 16:31357140-31357162 GAGGGAGGAGCCGGGGCCGCGGG + Intronic
1139468414 16:67166038-67166060 GAGCACCGAGGCGCGGCTGCGGG + Exonic
1141841957 16:86579215-86579237 CAGCGCGGAGGCGCAGCCGGAGG + Exonic
1142240171 16:88941356-88941378 GCGCGCGGGGCGGGGGCCGCGGG - Intronic
1142400922 16:89858435-89858457 GCACGCGGGGCCGCGGGCGCTGG - Exonic
1142523176 17:519238-519260 GTGCGGGGAGCCGCTGGCGCAGG + Exonic
1142631460 17:1229046-1229068 GGGCGCGCAGCCCCCGCCGCTGG - Intergenic
1142876398 17:2853932-2853954 GCGCGCGGAGCCGGGGCTGCGGG + Intronic
1143625984 17:8110360-8110382 GAGCCCGGCGCCGCCGCCCCGGG - Intronic
1144107285 17:11997436-11997458 GCGCCCGGAGCCGGCGCCGCGGG - Intronic
1144840637 17:18183785-18183807 GCGCGCGGAGCCGCGGTGGCCGG + Intronic
1145018340 17:19412952-19412974 GAGGGCGGAGCCGCTGCTGCTGG + Exonic
1145094018 17:20009371-20009393 GCGCCCGGAGCCGTGGCCGCTGG + Intronic
1145305747 17:21674251-21674273 GACCGCGGAGCGGCGGCTGCGGG + Intergenic
1145750759 17:27353753-27353775 GAGTGTGGAGACGCGGCCACAGG - Intergenic
1146126538 17:30235827-30235849 GAGCGCGGAGCCGCGGCCGCGGG - Exonic
1147564437 17:41527805-41527827 GTGGGCGGAGGCCCGGCCGCGGG - Intronic
1147896568 17:43755386-43755408 GGGCGCGGGGCCGCGGCTTCCGG + Exonic
1147994583 17:44353889-44353911 GGGGGCGGGGCCGCAGCCGCGGG - Exonic
1148760442 17:49997091-49997113 GGGCTCGGAGCGGCGGGCGCTGG - Intergenic
1150467174 17:65403376-65403398 GAGCCCGGAGCCGCGGGCCTTGG - Intergenic
1151558730 17:74859994-74860016 GGCCCCGGAGCCGCGGACGCCGG - Intronic
1151801732 17:76383289-76383311 GCGCGCGGAGCTGCGGCCCCAGG + Intronic
1153006237 18:500675-500697 GAGCGCGGAGCCGGGAGCGCGGG - Exonic
1153805468 18:8705868-8705890 GAGCGCGGGGCGGCGGGAGCCGG - Intronic
1154303969 18:13217703-13217725 GGACGCGGCGCTGCGGCCGCCGG - Intronic
1156008601 18:32471031-32471053 GCGCGCCGAGCCGCGGGCGCTGG - Intergenic
1157464293 18:47930773-47930795 GTGCGTGGCGCCGCGGCGGCCGG - Intronic
1158137562 18:54224142-54224164 GAGCGCGGGGCCGGGGCCCAGGG - Exonic
1160204620 18:76822669-76822691 GGGCGCGAGGGCGCGGCCGCGGG - Intronic
1160767026 19:813247-813269 GCGCGCGGGGCCGCCGCCGCTGG - Exonic
1160871700 19:1280755-1280777 GAGCGGGGGGCGGCGGCGGCTGG - Intergenic
1160968604 19:1757571-1757593 CCGCGCGGCCCCGCGGCCGCGGG + Intronic
1161031860 19:2061342-2061364 GCGCCCAGAGCCCCGGCCGCCGG - Intergenic
1161063735 19:2227664-2227686 AAGCGCAGAGCAGCAGCCGCAGG - Intronic
1161076875 19:2290106-2290128 TCGTGTGGAGCCGCGGCCGCGGG - Exonic
1161265116 19:3360215-3360237 GAGCGCGCCGCGGCCGCCGCCGG + Intronic
1161955065 19:7489095-7489117 TTGCGCGCAGGCGCGGCCGCAGG + Intronic
1162100400 19:8335359-8335381 GCGCGCCCAGCCCCGGCCGCGGG - Exonic
1162128235 19:8510865-8510887 GGGCGCGGCGGCCCGGCCGCGGG + Exonic
1162129022 19:8514019-8514041 GAGCGCGGCACCGGGGTCGCGGG - Intronic
1162374470 19:10296533-10296555 GAGGGCGGACCCGAGGCGGCGGG + Exonic
1163424264 19:17232489-17232511 GGGCGGGGAGCCGCAGCAGCAGG + Exonic
1163782546 19:19257997-19258019 GAGCGCGCTGCGGAGGCCGCAGG - Exonic
1165129175 19:33621702-33621724 GGGCGCGGTCCGGCGGCCGCGGG - Intergenic
1166121692 19:40690675-40690697 GGGCGGGGAGCCGAGGCCGAGGG - Intronic
1166792456 19:45406059-45406081 GAGGGCGGAGCCTCGGACCCAGG - Intronic
1167268250 19:48493882-48493904 GGGCGCGGCGGCGGGGCCGCGGG - Exonic
1167604939 19:50476615-50476637 GAGCCCGGGGCAGCGGCTGCCGG + Exonic
1168408126 19:56121181-56121203 GAGTGCGGCGCGGCGGCCCCGGG - Exonic
1202657486 1_KI270708v1_random:36995-37017 GAGCACGTAGCCGAGGCCGGTGG + Intergenic
1202669624 1_KI270709v1_random:39474-39496 GGGCAAGGAGCCGCGGCTGCGGG - Intergenic
924987766 2:287742-287764 GGGCGCGGAGCCCCGGGAGCCGG - Exonic
925984981 2:9207622-9207644 GAGCGCGGAGCTGCCCCCGCCGG - Intronic
926154987 2:10448573-10448595 GGGCGGGGAGAGGCGGCCGCAGG - Intergenic
928606189 2:32947077-32947099 GAGCGCGGAGCCCGGGGAGCGGG - Exonic
929452540 2:42047409-42047431 GAGCGAGGAGCCGCCACCCCCGG + Intergenic
929775389 2:44928360-44928382 CAGGGCGGAGCGGCGGCCGGGGG - Intergenic
930089538 2:47521600-47521622 GAGCGCGGAGCCGCGGCGGAAGG + Exonic
930684175 2:54290171-54290193 GATCGCGGGGCGGCGGCAGCCGG - Intronic
930700945 2:54457088-54457110 GGGCGCGGGGCCGCCGCCTCCGG - Intronic
932416520 2:71576685-71576707 GAGCGGGGAGCCGAGGGGGCCGG + Intronic
934467190 2:94273389-94273411 GGGCGGGGAACCGCGGCGGCAGG + Intergenic
934534443 2:95121624-95121646 AAGCGAGAAGCCGCGGCCCCCGG - Intronic
935255718 2:101308265-101308287 GGGCGCGGCCCCTCGGCCGCCGG + Exonic
935731127 2:106065663-106065685 GAGCGGGCAGGCGCGGCCGCGGG - Exonic
937997075 2:127702094-127702116 CAGCGCGGTGCCGCCGCCCCAGG - Exonic
938035064 2:128028268-128028290 GAGCGCCGGGGCGGGGCCGCAGG + Intergenic
938727296 2:134120154-134120176 GCGCCCGGGGCCGCCGCCGCGGG - Intronic
939613068 2:144332714-144332736 GTGCGAGGAGCCGAGCCCGCGGG - Intergenic
942241232 2:173965079-173965101 CAGCCCGGGGCCGCTGCCGCCGG - Intronic
942459116 2:176157431-176157453 GGGCGCGGGAGCGCGGCCGCAGG + Intronic
946339182 2:219057389-219057411 GGGCCCGGGGCCGGGGCCGCAGG - Intronic
947992212 2:234496886-234496908 GAGCGCGGGGGCGCGGCCCGAGG - Exonic
948116035 2:235494632-235494654 GGGCGCGGGGCGGCGGCGGCGGG + Exonic
948216713 2:236237814-236237836 GTGCAGGGCGCCGCGGCCGCCGG + Exonic
948903193 2:240966315-240966337 GAGCTCTGAGCTGCGGCCTCCGG - Intronic
1171523260 20:25791743-25791765 GACCGCGGAGCGGTGGCTGCGGG + Intronic
1171531002 20:25853718-25853740 GACCGCGGAGCGGCGGCTGCGGG + Intronic
1171553566 20:26064140-26064162 GACCGCGGAGCGGTGGCTGCGGG - Intergenic
1172015426 20:31870255-31870277 CAGCGCCGGGCCGCGGCGGCCGG + Intronic
1172033455 20:31996652-31996674 GAGCGCGAAGGCCAGGCCGCGGG - Exonic
1173165173 20:40682865-40682887 GAGCCCGGAGCAGCGGGCCCTGG + Intergenic
1173820158 20:46014275-46014297 GTGAGCGCCGCCGCGGCCGCCGG + Intronic
1174204394 20:48828175-48828197 GAGCGCCGCGCCGCGTCCCCAGG - Intergenic
1174475772 20:50794931-50794953 GAGCTGCGAGCCGCGACCGCCGG + Exonic
1174869878 20:54172970-54172992 GAGCGCGTACCCGCAGCGGCTGG - Exonic
1175382327 20:58572159-58572181 GTGCTCGGAGCCGAGGCAGCTGG - Intergenic
1175517251 20:59577471-59577493 CGGAGCGGAGCCGGGGCCGCGGG - Intergenic
1175981943 20:62743109-62743131 GAGCACGGAGCCGCCCCTGCTGG + Intronic
1176550192 21:8217423-8217445 CCGCGCGGAACCGCGGCCCCGGG - Intergenic
1176569120 21:8400461-8400483 CCGCGCGGAACCGCGGCCCCGGG - Intergenic
1176577034 21:8444693-8444715 CCGCGCGGAACCGCGGCCCCGGG - Intergenic
1178498879 21:33109772-33109794 GAGCGAGGACCTGCGGGCGCCGG - Intergenic
1179197889 21:39183157-39183179 GACCGCGGAGCCCCGGCCTTAGG + Intronic
1180965135 22:19784302-19784324 GAGCGCCCAGCAGCGGCGGCGGG + Exonic
1182364207 22:29766957-29766979 GAGCCCGGAGCTGCAGCCACCGG - Exonic
1182903912 22:33920611-33920633 GGGCGCGGGGCCGGGGGCGCGGG + Intronic
1183093687 22:35540324-35540346 GCGCGTGGGGCCGGGGCCGCTGG - Intergenic
1183667557 22:39254316-39254338 GAGCCCGGAGCCGAGGACGTGGG - Intergenic
1183961478 22:41414064-41414086 GAACGCGGAGGCGCTGCGGCAGG - Intergenic
1184767077 22:46577513-46577535 GAACCCGGACCTGCGGCCGCAGG - Intronic
1185186652 22:49404954-49404976 GAGCGGTGAGCCGCGGTCTCAGG - Intergenic
1185259325 22:49853235-49853257 GAGCGCGGGGCCGGGGCTGGCGG - Intergenic
1185272696 22:49936096-49936118 GAGCGCGGGGCCGGGGCGGCGGG - Intergenic
1185375767 22:50482014-50482036 GAGGGCGGCCCCGCGGCCCCCGG - Intronic
1203255087 22_KI270733v1_random:133761-133783 CCGCGCGGAACCGCGGCCCCGGG - Intergenic
1203263143 22_KI270733v1_random:178840-178862 CCGCGCGGAACCGCGGCCCCGGG - Intergenic
949987811 3:9553640-9553662 GCGCGCGAGGCTGCGGCCGCGGG + Intronic
950345519 3:12288443-12288465 GGGCGCGGAGCCGGGGACACGGG + Intronic
954803737 3:53202891-53202913 GAGGGCGGAGCAGCGGCCACCGG + Intergenic
958718943 3:97821928-97821950 CAGGGCGGTGCCGCGGCCACTGG + Intergenic
959530354 3:107429472-107429494 GAGCGCGGAGCTATGGCAGCTGG - Intergenic
963133171 3:141876763-141876785 GCGAGAGGAGCTGCGGCCGCGGG - Exonic
963236842 3:142964028-142964050 GGGCGGGGAGCTGCGGCTGCGGG + Intergenic
963939400 3:151085263-151085285 GAGACCGGAGCCGCGGAGGCGGG - Intergenic
966905984 3:184526027-184526049 GAGCGCGCAGCCCAGGCCTCTGG + Intronic
968393556 4:212883-212905 GAGGGCTGAGCGGCGGCAGCGGG - Intergenic
968450598 4:674369-674391 GAGCGGGGGGCCGCGCCCCCTGG + Intronic
968512957 4:1003348-1003370 GGGCGGGGCGCCGCGGCCACCGG - Exonic
968601880 4:1513373-1513395 GTGCGCGGCGCCGGAGCCGCTGG + Intergenic
968879770 4:3292977-3292999 GAGGGCGGGGCCGAGGCCGGAGG - Intergenic
975702087 4:77076019-77076041 GAGGGCGGAGCCGAGGAAGCCGG - Intergenic
976297240 4:83484847-83484869 GAAGGCAGAGCCGCGACCGCAGG + Intronic
976398562 4:84583110-84583132 GAAGGCGGAGACGCGGCCTCCGG - Exonic
978503650 4:109434132-109434154 GGGCGCGGTGCGGAGGCCGCGGG + Intronic
983061545 4:163166627-163166649 GAGCCCGGAGACGGAGCCGCCGG + Exonic
983296339 4:165873533-165873555 GCTCGCCGAGCCGCGGCCGCGGG + Exonic
983398495 4:167233915-167233937 GAGGCGGGGGCCGCGGCCGCCGG - Intronic
985068320 4:186144644-186144666 GTGCGCGGAGGAGTGGCCGCTGG + Intronic
985492884 5:189567-189589 GAGCCCAGAGCCGTGGCCCCAGG + Exonic
985895570 5:2748623-2748645 GAGGCCGGCGCGGCGGCCGCGGG + Exonic
986315357 5:6583201-6583223 GAACGCGGGGCCGCGGGGGCTGG + Intergenic
987193256 5:15500403-15500425 GTGCGCGGCGCTGCGCCCGCCGG + Exonic
988734655 5:34008112-34008134 GGGCGCGGCGCCGCGGCTGGGGG - Intronic
988823979 5:34915924-34915946 GCGCACAGAGCCGCCGCCGCAGG - Exonic
988949379 5:36241800-36241822 GTGGGCCGGGCCGCGGCCGCGGG + Intronic
989592217 5:43121843-43121865 GAGACCGGAGCCGCGGCCGCGGG - Exonic
990545165 5:56815359-56815381 GAGGGCGGCCCGGCGGCCGCAGG - Intergenic
992716308 5:79514224-79514246 CGCCGCGGAGCCGCGGCCGGGGG + Intergenic
992769604 5:80035214-80035236 GAGCAGCGAGCCGGGGCCGCAGG - Intronic
994670235 5:102755067-102755089 CAGGGCGGAGCAGAGGCCGCCGG + Intronic
996717710 5:126601094-126601116 GCGCGCGGAGCCTGGGCCCCGGG + Intronic
996978290 5:129460361-129460383 GGGCGAGAAGCCGCGGCCGCGGG + Exonic
997994611 5:138575586-138575608 GAGCTCAGAGCCGCCGCAGCCGG - Intergenic
1000014558 5:157266053-157266075 GGGGGCGGAGCCGCGGCGGGCGG + Intergenic
1001286373 5:170426946-170426968 GAGGGAAGAGGCGCGGCCGCAGG + Intronic
1001617835 5:173056831-173056853 GAGCCCGGGGCCGCTGCTGCCGG + Intronic
1002029390 5:176416619-176416641 GGTCGCCGAGCAGCGGCCGCAGG + Intergenic
1002176434 5:177403809-177403831 GACGGAGGAGCCGCGGCCCCTGG + Intronic
1002204550 5:177553926-177553948 GAGAGCGGAGCTGCGGCCTCGGG + Intronic
1002416105 5:179121761-179121783 GAGAGAGGGGCTGCGGCCGCAGG + Intronic
1002696834 5:181097904-181097926 GAGTGCGGCGCGGCGGCTGCAGG - Intergenic
1002697788 5:181101469-181101491 GAGTGCGGCGCGGCGGCTGCAGG + Intergenic
1003325086 6:5085185-5085207 GGGCGGGGAGGCGCGGCCGCTGG - Exonic
1004044673 6:12012375-12012397 GACCGGGGAGCGGCGGCCGCCGG + Exonic
1004216670 6:13710863-13710885 GAGAGCGGCGCAGCGGCGGCCGG + Intronic
1007327562 6:41073557-41073579 GAGCGGGGAGCGGGGGGCGCGGG - Intronic
1007630312 6:43269755-43269777 GCCCGAGGAGCCGCCGCCGCCGG - Intronic
1013232414 6:108169797-108169819 GCGCGCGGCGCGGCGGCCACCGG - Intronic
1013507572 6:110815262-110815284 GACCGCGGAGCGGCGGGCGGCGG - Exonic
1017282127 6:152636842-152636864 GGGCGCCGGGCCGCGGCCGCCGG - Intronic
1018674328 6:166205979-166206001 GAGCGCGCCACCGCGGCTGCTGG + Intergenic
1019343614 7:519607-519629 GAGCGCGGCGCCGGAGCCGAGGG - Intronic
1019562565 7:1665874-1665896 GAGCGCGGGGCGGCGGCGGCGGG - Intergenic
1020008072 7:4792677-4792699 GGCCGCTGAGCCGGGGCCGCAGG + Intronic
1022098581 7:27156077-27156099 GAGCGCGGAGCGCGGGGCGCGGG - Intronic
1024195320 7:47053136-47053158 GACGGCGGAGCCGCAGCCCCAGG + Intergenic
1025283704 7:57646676-57646698 GACCGTGGAGCGGCGGCTGCGGG + Intergenic
1025296191 7:57776721-57776743 GATGGCGGAGCGGCGGCTGCGGG - Intergenic
1025320142 7:58087058-58087080 GGGCAAGGAGCCGCGGCGGCGGG - Intergenic
1029896459 7:103989563-103989585 GAGCGCGGGACCGGGGCTGCGGG + Intergenic
1033300018 7:140177054-140177076 GCGCGCGAGGCCGCGGCGGCTGG + Intergenic
1034188372 7:149195972-149195994 CGGCGCGGAGCAGCGGTCGCCGG + Intronic
1034197875 7:149262076-149262098 GGGCGCGGGGCGGCGGCCGCGGG + Intergenic
1034533207 7:151710314-151710336 GAGAGCGAAGCCTCGGCAGCTGG - Intronic
1034977585 7:155457462-155457484 GCGCGCGGCGCCGCGGCCATTGG + Intergenic
1035672957 8:1434108-1434130 GAGCATGGAGACGTGGCCGCAGG + Intergenic
1036454131 8:8893172-8893194 GCGCTAGGACCCGCGGCCGCCGG - Exonic
1037879315 8:22565410-22565432 GAGCCGGGAGCCTCGGCGGCTGG + Intronic
1038176373 8:25184830-25184852 GAGCGCGGGGCGGCGGCGGCCGG + Intronic
1040038752 8:42896422-42896444 GCCCGCGGAGCCGCGGACGGCGG - Exonic
1041381707 8:57259318-57259340 GAGCACGGAGTCGTGGGCGCTGG - Intergenic
1041381771 8:57259612-57259634 GAGCGCGTGGTCGCGGGCGCTGG - Intergenic
1041839163 8:62248941-62248963 GAGCCGCGAGCGGCGGCCGCGGG + Exonic
1041919873 8:63169087-63169109 GGGCGCGGTGCCGCGGCGGGTGG + Intronic
1042591675 8:70403309-70403331 GAGCGCCGAGGCGCGGCCGGGGG - Intronic
1043388198 8:79768139-79768161 CGGGGAGGAGCCGCGGCCGCCGG - Intergenic
1043954190 8:86342589-86342611 GCGCGCGGTGCCGGGGCCGGCGG + Intergenic
1044591404 8:93917162-93917184 GCTCGCGGATCGGCGGCCGCGGG + Exonic
1045847737 8:106657866-106657888 GCGCGCGGAGCCGCCTCCCCTGG + Intronic
1047393726 8:124475036-124475058 GGGCCCGGGGCCGCGGCCGGGGG - Exonic
1049032413 8:140047581-140047603 CAGAGCTGAGCAGCGGCCGCTGG - Intronic
1049621236 8:143599219-143599241 CAGCGGGGAGCCGCTGGCGCAGG - Exonic
1049645227 8:143733172-143733194 GAGCTCGCGGCTGCGGCCGCTGG + Intronic
1049905709 9:214779-214801 GAGCTCGGAGCAGCGACGGCCGG - Exonic
1050552242 9:6758374-6758396 GAGCGGCCGGCCGCGGCCGCAGG + Intronic
1056143686 9:83708275-83708297 GCAGGCGCAGCCGCGGCCGCAGG - Intergenic
1057259744 9:93576934-93576956 GGGCGCGCAGCCGGGGGCGCGGG - Intronic
1057883103 9:98807959-98807981 GGGCGAGGAGCTGCGGCTGCAGG + Exonic
1060856044 9:126915297-126915319 GGGCGGGGCGCCGCGGCTGCAGG + Intronic
1060890337 9:127183986-127184008 GAGCGCGGAGCAGCAGATGCTGG - Intronic
1060982723 9:127803020-127803042 GAGCGCGTGGCCGGTGCCGCAGG + Exonic
1061262634 9:129488542-129488564 GGGCGTGGAGAGGCGGCCGCGGG - Intergenic
1061959224 9:133979586-133979608 GAGCCCGGAGCCACGGCCGCCGG + Intronic
1062425100 9:136502462-136502484 GACCGTGGAGCCGCCCCCGCCGG - Exonic
1062435747 9:136545941-136545963 GGGCGCGGAGCCGGGCCCGGGGG - Intergenic
1062646838 9:137552038-137552060 GAGCGGGTAGTCGCGGCCCCGGG - Intronic
1203471485 Un_GL000220v1:116898-116920 CCGCGCGGAACCGCGGCCCCGGG - Intergenic
1203479306 Un_GL000220v1:160870-160892 CCGCGCGGAACCGCGGCCCCGGG - Intergenic
1187419543 X:19122527-19122549 GGGGGCGGCGCCGAGGCCGCGGG - Exonic
1190024574 X:46912223-46912245 GAACGCGGCGCCGCGGGTGCGGG + Intergenic
1200003143 X:153072327-153072349 GAGCGCAGGGCCGTTGCCGCGGG - Intergenic
1200004580 X:153077682-153077704 GAGCGCAGGGCCGTTGCCGCGGG + Intergenic