ID: 1146128956

View in Genome Browser
Species Human (GRCh38)
Location 17:30253419-30253441
Sequence CTAGACTGTGAGGTTTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 8, 3: 58, 4: 367}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146128956_1146128963 22 Left 1146128956 17:30253419-30253441 CCCACAAAAACCTCACAGTCTAG 0: 1
1: 0
2: 8
3: 58
4: 367
Right 1146128963 17:30253464-30253486 CTATGTAGATAATGAACTTGTGG 0: 1
1: 0
2: 0
3: 21
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146128956 Original CRISPR CTAGACTGTGAGGTTTTTGT GGG (reversed) Intronic
900086666 1:901736-901758 CTAGACTGTGAGCTCCTTGGGGG - Intergenic
900162888 1:1232661-1232683 CTTGGCCGTGAGGTTTTCGTAGG - Exonic
900324758 1:2103151-2103173 CTAGACTGTGGGGTTTTTGGGGG + Intronic
901657477 1:10778258-10778280 TGAGATTGTGAGATTTTTGTGGG - Intronic
902603936 1:17558393-17558415 CTAGACTGTGAGTTCCTTGAAGG - Intronic
903360551 1:22774276-22774298 CTAGTCTGGGAGCTTTTTGAGGG + Intronic
904788715 1:33001637-33001659 CTAGACTGGGAGGTCCTTGGGGG + Intergenic
905025797 1:34848421-34848443 CTAGACTGTGAGTTCCTTGAGGG - Intronic
905123650 1:35702142-35702164 CTAGACTGTGAGCTTGATGAGGG + Intergenic
905328614 1:37176132-37176154 CTAGACTGTGAGCTTTCTGAGGG - Intergenic
906016117 1:42581714-42581736 CTAGAGTGTGAGATTTTTAAAGG + Intronic
906087771 1:43150577-43150599 CTAGATTGTGAGGTTCTTGAGGG + Intronic
906164420 1:43675298-43675320 CTAGACTGTGAGCTCCTTGAAGG - Intronic
906547685 1:46632838-46632860 CTAGACTGTGAGCTCCTTGAGGG - Exonic
906650147 1:47507501-47507523 CTAGACTGTTAGCTGTCTGTGGG + Intergenic
906728697 1:48062965-48062987 TTAGACTGTAAGCTTCTTGTGGG + Intergenic
907359679 1:53904451-53904473 CTAAAATGAGAGGTTTTTTTAGG - Intronic
907757605 1:57326098-57326120 CTAGACTGTGAGCTCCTTGAGGG - Intronic
908088210 1:60659459-60659481 CTAGCCTTTGATGGTTTTGTTGG + Intergenic
908173162 1:61528006-61528028 CTAGAATGTGAGCTTTATGAGGG + Intergenic
908425371 1:64002089-64002111 CCAGACTGTAAGGTTTTAGAAGG + Intronic
908539463 1:65109121-65109143 CTAGACTGTGAGCTGCTTGAGGG + Intergenic
908864240 1:68528067-68528089 CTAGACTGTGAGCTCCTTGATGG - Intergenic
909061637 1:70885703-70885725 CTAGACTGTGAGCTTGGTGAAGG - Intronic
909727602 1:78854261-78854283 CTAAACTGTGAGCTTCTTGAAGG - Intergenic
910120314 1:83781507-83781529 CTAGACTGTGACTTTCTTGAGGG - Intergenic
910542910 1:88381075-88381097 CTAGACTGTAAGTTTTTTGAAGG + Intergenic
910823108 1:91372874-91372896 TTTGACTGTGAGCTCTTTGTTGG + Intronic
912179837 1:107206474-107206496 CTAGACTGGGAGGTCTTTCTAGG + Intronic
915478431 1:156168518-156168540 CTGGCCTCTCAGGTTTTTGTTGG + Intronic
915800359 1:158785012-158785034 CTAAACTGTAAGCTTTTTGAGGG + Intergenic
916308395 1:163366220-163366242 CTAGACTGTGAGGTTCTGGAAGG + Intergenic
916421609 1:164642740-164642762 CTAGACTGTGAGCTCCTTGAAGG - Intronic
917497595 1:175555346-175555368 CTAGCCTGAGAGGTTTTATTAGG - Intronic
917857869 1:179116457-179116479 CTAGACTGTGAGCTCTCTGAAGG + Intronic
918083797 1:181228163-181228185 CTATACTGTTGGGTCTTTGTGGG + Intergenic
918232524 1:182549086-182549108 CAAGAATGTGAGGTTTTCTTAGG + Intronic
919241215 1:194918976-194918998 CTAGACTGTGAGCTTCTGGATGG + Intergenic
920021630 1:202960821-202960843 TTAGACTGTGAGTTCTTTGGGGG + Intergenic
920255095 1:204649308-204649330 CTAGACTGTGAGGTCCTAGAGGG + Intronic
920699707 1:208208670-208208692 CTAGCCTGTGTGGTTTCTGCTGG + Intronic
921231412 1:213076043-213076065 CTAGACTGTGAACTCTTTGAAGG + Intronic
921780524 1:219157582-219157604 CTAGACTGTTAGGGTTTTAAGGG - Intergenic
922640437 1:227224562-227224584 CTGGAATATAAGGTTTTTGTTGG - Intronic
923117229 1:230953377-230953399 CTAGACTGGAAGGCATTTGTTGG + Intronic
923695070 1:236240749-236240771 CTAGATTGTGAGCTATTTGAGGG - Intronic
924161541 1:241238067-241238089 CTAGCCTGTGAGGCCTTTGAGGG - Intronic
1063534558 10:6870519-6870541 GTAGACTGTGAGCTTCTTGAGGG + Intergenic
1064030898 10:11881987-11882009 CTAGACTGTGAGGCCTGTGTGGG - Intergenic
1064229896 10:13520744-13520766 CTACACTGTGAGGTTGCTGTTGG - Intronic
1067701274 10:48574691-48574713 CAAAGGTGTGAGGTTTTTGTGGG + Intronic
1068205194 10:53841367-53841389 CTATATTTTGAGGTTTTTTTAGG + Intronic
1069416339 10:68204174-68204196 CTAGACTGTGAGCATCTTGAAGG + Intronic
1070163345 10:73879538-73879560 ATAGACTGTGAGCTTCTTGAAGG + Intergenic
1070528506 10:77315890-77315912 CTAGACTGTGGGTTCTCTGTGGG + Intronic
1072040754 10:91603904-91603926 CTAGACTGTGAGCTTCTTGAGGG + Intergenic
1073226052 10:101920140-101920162 CTAGGCTGTGAGCTCTTTGAAGG - Intronic
1074088186 10:110224568-110224590 CTAGACTTTGAGGATTTTTTAGG + Intronic
1074747704 10:116551867-116551889 CTTGACACTGAGGTTTTTGAAGG + Intronic
1074775317 10:116763718-116763740 CTGGACTAGGAGGTTTTTTTGGG + Intergenic
1077886832 11:6393091-6393113 CTAGACTGTGAGCTCCTTGCAGG + Intronic
1078471213 11:11588267-11588289 TTGGACTGTGAGCTTTTTGTAGG + Intronic
1078849067 11:15147676-15147698 CTAGACTGTGAGCTTCTTGAGGG - Intronic
1078922395 11:15842814-15842836 CTAGACTGTGGGTTTCTTGAGGG + Intergenic
1078974854 11:16461920-16461942 CTAGACTCTAAGGTTCTTGAGGG + Intronic
1079069882 11:17335075-17335097 CTACATTGAGTGGTTTTTGTAGG - Intronic
1080148645 11:29021527-29021549 TTACTCTGTGAGGTTTTTGATGG + Intergenic
1080264748 11:30388884-30388906 CTAGACTAGGAAGTTTTTGAAGG + Intronic
1080373707 11:31682676-31682698 CTAGACTATGAGCTCTTTATGGG - Intronic
1080452124 11:32386310-32386332 ATAGACTGTGAGGAGTTAGTGGG - Intergenic
1080563956 11:33491065-33491087 CTAGACTCTGAGTTTCTTGAGGG + Intergenic
1080586053 11:33683570-33683592 CTTGACTGTGAGCTTTGTGAGGG - Intergenic
1080932153 11:36822187-36822209 CTAGACTCTGAGGTTCATGAGGG + Intergenic
1081621606 11:44622195-44622217 CCAGCCTGTGAGGTTTTGGGAGG + Intergenic
1081656514 11:44861252-44861274 CTTGACTTTGGGATTTTTGTTGG - Intronic
1081767559 11:45622061-45622083 CTAGGCTGTGAGCTTTCTGAGGG - Intergenic
1081780661 11:45709277-45709299 CTAGACTGTGAATTCTTTGAAGG - Intergenic
1081781064 11:45713126-45713148 CTAGACTGGGAGCTCTTTGGGGG - Intergenic
1083083146 11:60114332-60114354 CTAGACTTTCAGGTTTATTTTGG + Intergenic
1083113084 11:60431226-60431248 CTAGACTGAGAGGTCTTTGGGGG - Intronic
1084171080 11:67401426-67401448 CTGCGCTGTGAGGTTTTTGGTGG - Intronic
1084883117 11:72186198-72186220 TTAGATTTTGAAGTTTTTGTGGG - Intergenic
1085062229 11:73458143-73458165 CTAGACTGTGAGCTCCTTGAGGG - Intronic
1085554405 11:77406842-77406864 TTAGTCTGTGAGATTTTTGAGGG - Intronic
1085767133 11:79292986-79293008 TTGGACTGTGAGGTTTCTGAGGG - Intronic
1085780297 11:79402028-79402050 CTAGACTGTGAGCTTCTAGAGGG - Intronic
1086912006 11:92483541-92483563 CTAGACTGTGAGATCTCTGTGGG + Intronic
1087601070 11:100316366-100316388 TTAGACTGTGAGCTTTTTGAGGG - Intronic
1087906222 11:103700691-103700713 CTGGAATGTGAGCTTTCTGTTGG + Intergenic
1088037524 11:105334956-105334978 CTTACCTTTGAGGTTTTTGTAGG - Intergenic
1088299878 11:108345601-108345623 CCAGACTGTTAGCTTCTTGTAGG + Intronic
1088438897 11:109846558-109846580 CCAGACAGTGAGATTTTTGGAGG - Intergenic
1089029657 11:115312061-115312083 CCAGACTGTGAGCTTCTTGTAGG - Intronic
1089795619 11:120978199-120978221 CTACACTGTGAGCTCTTTGAGGG - Intronic
1090067393 11:123514864-123514886 CTAGACTGTGAGCTCCTTGAGGG + Intergenic
1090384500 11:126348721-126348743 CTAGACTGAGAGGGTCTTGAGGG + Intergenic
1090946114 11:131431062-131431084 CAAGACTGTGGGGATTTTGCAGG - Intronic
1091133454 11:133166187-133166209 CTGAACTGTGAGGATCTTGTAGG - Intronic
1095129597 12:38523396-38523418 CTATATTGTGAGTTTCTTGTTGG - Intergenic
1095651425 12:44615033-44615055 CTAAACTGTAAGCTTTTTGAAGG - Intronic
1098886761 12:75968462-75968484 CTATACTGTGAGTTCCTTGTGGG + Intergenic
1105476934 13:20736318-20736340 CTTGATTGTGATGGTTTTGTTGG - Intronic
1105932724 13:25067804-25067826 CTAGACTGTGAGCTACTTGAAGG + Intergenic
1107051294 13:36053266-36053288 CTAGACTGTGAGCTTCTTGTAGG - Intronic
1107389525 13:39949116-39949138 AGAGACTATGAGGTTTTTCTAGG - Intergenic
1107721385 13:43252275-43252297 TGAGACTTTGAGGTTTTTCTTGG + Intronic
1107861120 13:44661669-44661691 CTAGACTGTGAGCTCCTTGATGG + Intergenic
1108030185 13:46221057-46221079 CTAAATTGTGAGATATTTGTTGG + Intronic
1108333608 13:49415716-49415738 CTAGAATGTGAGCTTTGTGAGGG + Intronic
1108372527 13:49784855-49784877 CTAGATTGTGAGCTTTTTGAGGG - Intronic
1108410111 13:50137367-50137389 CTAGACTTGGAGGTCCTTGTTGG - Intronic
1108413246 13:50171734-50171756 CTAGACTGTGAGGTTTTCTAAGG + Intronic
1108450683 13:50559672-50559694 CTAGACTGTCAGAGTTTTCTTGG - Intronic
1109440499 13:62365277-62365299 CTACACAGTGAGTCTTTTGTTGG - Intergenic
1109579953 13:64317197-64317219 TTAAACTGTGAGGTTTTGGAAGG + Intergenic
1110201170 13:72851784-72851806 CCAGAGTCTGGGGTTTTTGTGGG - Intronic
1112185964 13:97127978-97128000 CTAGATTTTCAGGTTTCTGTAGG + Intergenic
1112936419 13:104805338-104805360 CTAAAATGTAAGGCTTTTGTGGG + Intergenic
1113387345 13:109860969-109860991 CTAGACTCTGAGCTCTTTGAGGG + Intergenic
1114737669 14:25059373-25059395 TCAGACTGTGAGGTCTATGTTGG - Intergenic
1115070168 14:29312687-29312709 CTAGACTGTGAGCTCTCTGATGG - Intergenic
1115480406 14:33855689-33855711 CTAGACTGTAAACTTTATGTAGG - Intergenic
1115760775 14:36578361-36578383 CTAGGCTGTCAGATTTTTGGGGG - Intergenic
1116073251 14:40075795-40075817 CTAGATTGTAAGCTTTTTGAGGG - Intergenic
1116595694 14:46841493-46841515 GTTTACAGTGAGGTTTTTGTTGG + Exonic
1118453027 14:65921213-65921235 CTAGACTGAGAGGTCTACGTGGG + Intergenic
1118549466 14:66933833-66933855 CTAGACTGTGAACTTTTTATGGG - Intronic
1118692246 14:68351455-68351477 CTAGACTGTAAGCTTTGTGTGGG - Intronic
1119890014 14:78175454-78175476 CTAGGCAGTGAGGTTTTAGAAGG - Intergenic
1121052157 14:90826588-90826610 CTAGACTGTGAGTTCCTTGAGGG - Intergenic
1122373930 14:101246049-101246071 ATAGAATGCGAGGTTTTGGTAGG + Intergenic
1122373961 14:101246319-101246341 ATAGAATGCGAGGTTTTGGTAGG + Intergenic
1122373987 14:101246553-101246575 ATAGAATGCGAGGTTTTGGTAGG + Intergenic
1123759772 15:23423208-23423230 CTTGACTTTGAGGTCTTCGTGGG - Intergenic
1124094029 15:26631956-26631978 CTAGATTGTGAGCTTTTTAAAGG - Intronic
1124198692 15:27657452-27657474 CTAGACTGTGAGCTATTGATGGG + Intergenic
1124624901 15:31302244-31302266 CCAGACTGTGAGCTTCTTGGGGG - Intergenic
1125870743 15:43099745-43099767 CTAGACAGTGAAGTTCTTGAAGG - Intronic
1126529357 15:49695561-49695583 CTAAACAGTGAGCTTTTTGGGGG - Intergenic
1128706905 15:69843182-69843204 CTAGACTGTGAGCTTCATGGGGG - Intergenic
1128921164 15:71611558-71611580 CTAGACTGGGAGCTCTTTGGGGG - Intronic
1129099696 15:73248693-73248715 CTAGACTGGGAGTTCTTTGTGGG + Intronic
1130539946 15:84815324-84815346 TTAGACTGTGAGCTTCTTGCAGG + Intergenic
1130671448 15:85916417-85916439 ATAGACTCTGGGGTTTTTGTGGG - Intergenic
1133842199 16:9420085-9420107 CTAAACTGTGAGCTGTTGGTAGG + Intergenic
1134141046 16:11719728-11719750 CTAGACTGTAAGATTTCTGAGGG - Intronic
1135509083 16:23066741-23066763 CTTATCTGTGAGGTTTTTTTTGG + Exonic
1135870982 16:26150178-26150200 CTAGACTGTGAGCTCCTTGGAGG + Intergenic
1136397701 16:30002038-30002060 CTAGACTGTGAGCTCTGTGAGGG - Intronic
1136578461 16:31138382-31138404 CTAGATTGGGAGGACTTTGTGGG + Intergenic
1136776581 16:32874987-32875009 CTAGACTGTGAGCTGCTTGAGGG + Intergenic
1136894034 16:33986526-33986548 CTAGACTGTGAGCTGCTTGAGGG - Intergenic
1137447140 16:48538817-48538839 CTAGACTGTGAGCTCCTCGTGGG - Exonic
1138077486 16:54057015-54057037 CTAGACTGTGAGTTCTTTGAAGG - Intronic
1138545186 16:57714661-57714683 CTGGACAGTGAGGTTTCTATCGG + Intronic
1139846779 16:69927115-69927137 CTAGACTATGACAGTTTTGTGGG - Intronic
1140368185 16:74397658-74397680 AGAGACTGTGAGGTTCTTCTGGG - Intergenic
1141240600 16:82261928-82261950 CTAGACTGTGAGCTCTTCGAAGG - Intergenic
1141474407 16:84262928-84262950 CCAGAATGTGAGGTTTCTCTTGG + Intergenic
1141808111 16:86355435-86355457 CTAGACTGTGAGCTCTGTGGGGG - Intergenic
1203078996 16_KI270728v1_random:1137096-1137118 CTAGACTGTGAGCTGCTTGAGGG + Intergenic
1143052071 17:4134452-4134474 CTAGGCTGTGAGGTTTTTGAAGG - Intronic
1145952195 17:28827398-28827420 CTGGATTGTGAGCTTTTTGTAGG - Intronic
1145965647 17:28914967-28914989 CTAGACTGTGAGCTCCTTGAGGG - Intronic
1146128956 17:30253419-30253441 CTAGACTGTGAGGTTTTTGTGGG - Intronic
1146220062 17:31009993-31010015 CTAGACTTTGAGATTTATTTGGG + Intergenic
1148339904 17:46867178-46867200 CCAGACTGTGAGCTTCTTGAGGG + Intronic
1149005831 17:51804426-51804448 CTAGTCTGAGAGGATCTTGTGGG - Intronic
1149340119 17:55676687-55676709 CTAGCCTATGCGGTATTTGTAGG + Intergenic
1150333462 17:64313027-64313049 CTAGATTGTGAGATGTTTGTAGG - Intergenic
1151366588 17:73621046-73621068 CTAGACTGTGAGTTTCCTCTTGG - Intronic
1152025040 17:77803340-77803362 CAAGAGTGTGAGATTTTTCTAGG - Intergenic
1153059905 18:984219-984241 CTAGACTGTGAGCTCTTGGAAGG + Intergenic
1153122758 18:1750092-1750114 CTATAGTGTGAGGTTTTATTTGG - Intergenic
1153976306 18:10271224-10271246 CTAGACTGTGAGTTTTTCAAGGG - Intergenic
1154489462 18:14908612-14908634 CTAATCTGTGAGGTCTTTGAGGG + Intergenic
1155528801 18:26744869-26744891 CTAGACTGTGAGCTGCTTGAAGG + Intergenic
1155686163 18:28554103-28554125 CTTTACTCTGAGGATTTTGTAGG - Intergenic
1157187163 18:45550474-45550496 CTAGACTGTGAGCTCTCTGAAGG + Intronic
1157424444 18:47572530-47572552 GGAGAATGTGAGGTTTTTCTGGG + Intergenic
1158985267 18:62808948-62808970 CTAGACTTTAAGTTTTTTGAGGG + Intronic
1161308216 19:3578740-3578762 CTCGGCTGTGAGGTTCTTCTGGG - Exonic
1162177949 19:8845816-8845838 CTAGAATGTGGGGATTTTTTTGG - Intergenic
1163413759 19:17172983-17173005 CTCGACAGTGACGCTTTTGTGGG - Intronic
1163890655 19:20009676-20009698 CCAGATTGTAAGGTTTCTGTGGG - Intronic
1165181232 19:33972802-33972824 CTAGCCTATGTGGTTTCTGTAGG - Intergenic
926236146 2:11045559-11045581 CTGGACTGTGAGCTTCTTGTAGG - Intergenic
926400138 2:12488520-12488542 CTAGACTGTGAGCTTTTTAAGGG + Intergenic
926978131 2:18535316-18535338 CTAGACTGTGAGTACTTTGATGG + Intergenic
927114586 2:19888058-19888080 CAAGGGTTTGAGGTTTTTGTGGG - Intergenic
927276051 2:21263306-21263328 CTAGACTGTGATCTCTTTGAAGG + Intergenic
927662456 2:25004559-25004581 CTTGATTGTAAGGTTTTTATGGG - Intergenic
928060496 2:28107767-28107789 CTAGACTGTGAAGATTTTGAGGG + Intronic
928166781 2:28977689-28977711 CTAGACTGTGAGCTCCTTGGGGG - Intronic
928582216 2:32720253-32720275 CTAGAATGTGAGCTTCTTGAGGG + Intronic
930206972 2:48597429-48597451 TCAGACTGTGAGTTCTTTGTGGG - Exonic
930892872 2:56411534-56411556 CTAGACAGTGAGGTTATTTTAGG - Intergenic
931642565 2:64394812-64394834 CTAGACTATGGGGTTCTTGGAGG + Intergenic
932018308 2:68056079-68056101 CTAGAATGTGAGCCTTTTGTTGG - Intronic
934975624 2:98800161-98800183 CTAGACTTTGAGCTTTTTGAAGG - Intronic
935047193 2:99493014-99493036 CTACACTGGGAGCTTTTTGGGGG - Intergenic
935752897 2:106253673-106253695 TTGGACTGTAAGGTTTATGTAGG - Intergenic
935913315 2:107921205-107921227 TTGGACTGTAAGGTTTATGTAGG - Intergenic
937074117 2:119088610-119088632 CTAGACTGTGAGCCTTTTGAGGG + Intergenic
937135285 2:119546434-119546456 CTTAACTGATAGGTTTTTGTGGG + Intronic
937211221 2:120272906-120272928 CTAGTCTTTGAGTTTTTTGAGGG + Intronic
937839556 2:126511683-126511705 CTAGACCATGAGGTCTGTGTGGG + Intergenic
939672663 2:145032787-145032809 CTAGACTGTAAGATATTTGAAGG - Intergenic
939727592 2:145742312-145742334 CTAGGATTTCAGGTTTTTGTAGG - Intergenic
940277813 2:151957783-151957805 GTAGACTGGAAGGATTTTGTGGG - Intronic
941275259 2:163482958-163482980 CCAGTCTGTGGGGTTTATGTTGG + Intergenic
941319693 2:164039706-164039728 CTAGAATGTGAGCTTTTTGAGGG + Intergenic
941654207 2:168125852-168125874 CCAAAATGTGATGTTTTTGTTGG - Intronic
942382179 2:175403588-175403610 CTAAACTGTAAGTTTTTTGAAGG - Intergenic
942673190 2:178398992-178399014 CTAGATAATGAGGTGTTTGTGGG + Intronic
942967316 2:181912245-181912267 CTAGATTGTGAGCCTTTTGAAGG - Intronic
944171526 2:196784203-196784225 CTACACTGTGAGGATTTTGATGG - Intronic
944478510 2:200130939-200130961 CTAGGCTGTGAGGTCTCTGAGGG - Intergenic
944831540 2:203538040-203538062 CTAGACTGTATGCTTTTTGTAGG - Intergenic
945334852 2:208580125-208580147 TTAGGTTTTGAGGTTTTTGTTGG + Intronic
947717657 2:232349998-232350020 CTAGCCTCTGAGCTTATTGTCGG - Intergenic
947728760 2:232416864-232416886 CTAGCCTGTGAGCTTATTGTCGG - Intergenic
947938817 2:234030815-234030837 CTAGACTGTGGGTTTTTTGAAGG - Intergenic
948341433 2:237255880-237255902 CTAGGATGTGAGAATTTTGTGGG + Intergenic
1168863561 20:1064156-1064178 CTAGACTGTGTGCTTTGTGAGGG + Intergenic
1169661748 20:7986026-7986048 CCATAGTGTGAGGTTCTTGTAGG - Intronic
1169817142 20:9669508-9669530 TTAAAATTTGAGGTTTTTGTAGG + Intronic
1172266275 20:33617344-33617366 CTAGACTATGAGATCTTTGAGGG + Intronic
1173051528 20:39566837-39566859 CTACACTGTGAGCTCTTTGAGGG + Intergenic
1173663235 20:44748305-44748327 CTAGACTTTGAGCTCTTTGAGGG - Intronic
1173670529 20:44795655-44795677 CTACTCTGTGAGGTTGTTTTGGG - Intronic
1174574993 20:51530912-51530934 CTAGACTCTGAGGTTCTTAGAGG + Intronic
1174735540 20:52962434-52962456 CTAAACTGTGAGCTTTCTGAGGG - Intergenic
1174757339 20:53173130-53173152 CTAGACTGTAAGCTTCTTGAAGG - Intronic
1178029454 21:28507244-28507266 GTAAACTGAGAGTTTTTTGTGGG - Intergenic
1179049735 21:37878951-37878973 CTAGACTGTGACCTTCTTGAGGG + Intronic
1180592125 22:16949236-16949258 GTAGACTGTGAGTTTCTGGTGGG + Intergenic
1181286721 22:21757823-21757845 CCAGCCTGTGATGTTTCTGTGGG - Exonic
1181744929 22:24949582-24949604 CTAGGCTGTGAGGTCCTTGTGGG - Intergenic
1181996729 22:26888723-26888745 CTAGACTGTGAGCTTTGTGAGGG + Intergenic
1183947292 22:41333781-41333803 CTAGACTGTGAGCTCTTTGAGGG - Intronic
1184061206 22:42082895-42082917 CTAGACTCTGAGCTTCTTGCTGG + Intronic
949300332 3:2576169-2576191 CTAGACTGTAAGGTTTATTTGGG + Intronic
949494999 3:4622922-4622944 CTAGACTGTAAGGTCTCTGAAGG - Intronic
949763526 3:7499730-7499752 TTAAACTGTGAGGTTTTTGCTGG - Intronic
950218111 3:11174205-11174227 CTAGACTGTGAAGTTCTTTAGGG + Intronic
952246239 3:31595715-31595737 CTAGATTGTGAGCTTTTTGTGGG + Intronic
952520213 3:34149396-34149418 CTAGGCTGTGAGTTTCTTGGGGG + Intergenic
952696540 3:36270905-36270927 CTAGAGTGTGAGGTCATTGAGGG - Intergenic
955703370 3:61704187-61704209 GTAGACGGCCAGGTTTTTGTGGG + Intronic
956462196 3:69483905-69483927 CTGCTCAGTGAGGTTTTTGTCGG + Intronic
957668702 3:83271731-83271753 CTAGACTTAGAGGTCTTTTTGGG - Intergenic
958112478 3:89166294-89166316 CTAAATTATGAGGTTTCTGTGGG + Intronic
958784619 3:98584238-98584260 CTAAACTATGAGGTTCTTTTTGG + Intronic
958863656 3:99474309-99474331 CAAGACAGTGTGGTGTTTGTAGG - Intergenic
959636885 3:108584945-108584967 CTAGACTGAGAAGTCTTTGAAGG + Intronic
959932266 3:111997906-111997928 CTAGACTGTAAGCCATTTGTGGG - Intergenic
960173542 3:114491009-114491031 CTGGACTGTGAGCTATTTGAAGG + Intronic
960176318 3:114522044-114522066 CATGATTGTGAGGTTTTTTTCGG - Intronic
960673416 3:120173041-120173063 CTAGACTGTGAGCTCTGTGAGGG + Intronic
961073150 3:123955616-123955638 AGAGACTGTCAGGGTTTTGTAGG - Intronic
961132474 3:124481938-124481960 CTAGACTGTAAGCTTTTTGAGGG + Intronic
962047806 3:131778925-131778947 AGAGACTGTGAGGTTTTTCTAGG - Intronic
962186238 3:133262771-133262793 CTAGACTGTAAGTTCTTTGAAGG - Intronic
962439075 3:135395212-135395234 CTAGGCTTTGAGGGTTGTGTAGG - Intergenic
962471334 3:135711865-135711887 CTAGACTCTGAGCTTCTTTTGGG + Intergenic
962522186 3:136207660-136207682 CTAGACTGTGAACTCTTTGAGGG - Intergenic
962631826 3:137284278-137284300 CTAGACTGTGACTTTCTTGCAGG - Intergenic
962832952 3:139160092-139160114 CTAAACTGTCAGTTTTTTGGAGG + Intronic
963595961 3:147325296-147325318 CTAAACTCTGAGGAGTTTGTAGG - Intergenic
963766431 3:149340890-149340912 CTAGACTCTGAGCATTTTGAAGG - Intergenic
963812846 3:149796525-149796547 CTAGACTGTGAGCTTCCTGATGG + Intronic
965409205 3:168308487-168308509 CCAGACTGTGAGCTTCTTGAAGG + Intergenic
965785715 3:172332459-172332481 CTGGAATGTGAGCTTCTTGTGGG + Intronic
966625126 3:182007519-182007541 CTAGACTGTGAACTTCTTGAGGG - Intergenic
967516520 3:190375707-190375729 CTATCCAGCGAGGTTTTTGTGGG + Intronic
967861065 3:194152103-194152125 CTAGACTGTGATGTCCTTGAAGG - Intergenic
967971656 3:195003864-195003886 CTAGACTGTGAGCTTTTTAAGGG + Intergenic
969949340 4:10817926-10817948 AAATACAGTGAGGTTTTTGTAGG + Intergenic
971008331 4:22401471-22401493 CTAACCTGTGTGGTCTTTGTGGG - Exonic
971331866 4:25688307-25688329 CTAGATTGAGGGGTTTTTGGAGG - Intergenic
973178359 4:47236304-47236326 CAAGACTGTAAACTTTTTGTTGG - Intronic
975091658 4:70411097-70411119 CTTACCTGTGAGATTTTTGTTGG - Intergenic
976489184 4:85647921-85647943 CTAGAATGTAAGCTTTATGTGGG + Intronic
976559359 4:86483745-86483767 CTAGACTGTGAGCTGTTAGAGGG - Intronic
977043375 4:92041073-92041095 GTAGACTGTGAGCTGTATGTGGG - Intergenic
977224289 4:94375973-94375995 CTAGACTGTAAGCTTTTTGAAGG + Intergenic
977685865 4:99847155-99847177 CTAGCCTGTAAGGTGTTTGAAGG - Intronic
979930624 4:126625566-126625588 TTAGACTGTGAGCTTTTGTTAGG + Intergenic
980100731 4:128539122-128539144 CTAGGGTCTCAGGTTTTTGTAGG + Intergenic
980963596 4:139499902-139499924 CTAGACAGAGAGGTTTTGCTAGG + Intronic
982385589 4:154797834-154797856 AGAGGCTGTGAAGTTTTTGTAGG + Exonic
983488790 4:168363113-168363135 CTGGCCTGTGAGGTTTCTGCTGG - Intronic
984168445 4:176332131-176332153 CTAGACTGTAAGCTCTTTGAGGG + Exonic
985126327 4:186698422-186698444 CTAGATTGTCAGCTCTTTGTGGG - Intronic
986513545 5:8535222-8535244 CTAAACAGTGAGGTTGTTGTGGG - Intergenic
988643726 5:33070265-33070287 CTAGACTGTCAAGTATTTGTGGG - Intergenic
988981445 5:36573447-36573469 ATAGACCTTGAGGCTTTTGTTGG + Intergenic
989428934 5:41329332-41329354 CTAGACTGTAAGCTCTTTGAGGG + Intronic
989633825 5:43513552-43513574 CCAGACTGTGTGGCCTTTGTAGG - Intronic
989657369 5:43759536-43759558 CTGACCTTTGAGGTTTTTGTGGG + Intergenic
993424502 5:87746438-87746460 CTAGCCTTTGAGGTAGTTGTGGG + Intergenic
993978119 5:94507461-94507483 ATAGCCTGTCAGGTTTTTTTGGG - Intronic
994104294 5:95929218-95929240 CCAGACTGTGAGTTCTTTGGAGG + Intronic
994155847 5:96503612-96503634 TCAGACTGTGAGGTCTCTGTGGG - Intergenic
995042279 5:107602621-107602643 CCAGCCTGTGAGGTGTTTGGGGG - Intronic
995079949 5:108038388-108038410 CTAAACTTTGAGGGTTTTTTTGG - Intronic
995865179 5:116682822-116682844 CTAGACTCTGAGGTTTTTGATGG + Intergenic
996612720 5:125402531-125402553 CTAAACTTTGAGCTCTTTGTAGG - Intergenic
997293877 5:132757561-132757583 CTAGACTGTGAGCTCCTTGAGGG + Intronic
997763914 5:136479936-136479958 ATAGACTGTGATGTTTTCATGGG - Intergenic
998052035 5:139043856-139043878 CAAGACTGTCAGGTTGGTGTTGG + Intronic
998175193 5:139897531-139897553 CTAGACTGTGAGGAGCTGGTGGG + Intronic
998190271 5:140018066-140018088 GTAGATTTTGAGGTTTTTCTTGG - Intronic
998370414 5:141657028-141657050 CTAGACTGTGTGCTTTGTGAAGG - Intronic
998705539 5:144755444-144755466 CTAGACTGTCAGCTCTTTGAGGG - Intergenic
999180612 5:149667568-149667590 CTATACTGTGAGGTTCCTGAAGG + Intergenic
999633638 5:153597705-153597727 CTAGACTGTGATTTTCTTGAGGG - Intronic
1000345015 5:160307273-160307295 CTAGACTGTGAGCTCCTTGCAGG - Intronic
1000473647 5:161677725-161677747 CTAGAATGTGAGCTTTCTGAAGG + Intronic
1001003633 5:168030596-168030618 CCAGACAGTGAGCTTTTTGAGGG + Intronic
1001643667 5:173264005-173264027 ATAGACTGTGAGAATTTTATTGG - Intergenic
1001908999 5:175498898-175498920 CTGGCCTTTGAGATTTTTGTGGG - Intronic
1001953820 5:175834436-175834458 CCAGACTGTGAGGTCCTTGAGGG - Intronic
1002851406 6:999976-999998 CTAGACTTCAATGTTTTTGTGGG - Intergenic
1003692809 6:8371534-8371556 CTAGACTGTGAGCTTCCTGAGGG + Intergenic
1003996262 6:11543158-11543180 CTAGACTGTGAGCTTTTTGAGGG + Intronic
1003998981 6:11575551-11575573 CTACACTTTGAGGTTTCTGTGGG + Exonic
1004530681 6:16452201-16452223 CCAGACTGTGAGCTTTTTGAGGG + Intronic
1005277872 6:24239133-24239155 CTGGACTGTGAGGTGCTTGAGGG - Intronic
1005880871 6:30059842-30059864 TTAGACTGTGAGCTTTTGTTGGG + Intronic
1006127076 6:31845935-31845957 CTAGACTGGGAGGACCTTGTTGG - Intergenic
1006725771 6:36197748-36197770 CTAGACTGTAAGCTCCTTGTGGG + Intronic
1006776487 6:36596784-36596806 TTGGACTGTAAGGTTTATGTAGG + Exonic
1007488144 6:42196763-42196785 CTAGACCTTGAGGTGTGTGTGGG - Intergenic
1008761692 6:54859527-54859549 CTAGACTGTGAGCTCTATGATGG - Intronic
1008932091 6:56952080-56952102 CTAGACTGTGAGCTCCTTGAGGG - Intronic
1009392203 6:63157629-63157651 ATAAACTGTGAGCTTTTTGAAGG - Intergenic
1012723975 6:102784550-102784572 CTAAAATGTGAGATTTTGGTGGG - Intergenic
1013126593 6:107190493-107190515 CTAGACTGTGAGCTCTTGGAGGG - Intronic
1014180361 6:118377774-118377796 ATAGTATTTGAGGTTTTTGTTGG - Intergenic
1014769251 6:125442736-125442758 CTAGACTATAAGGTCTTTGAGGG + Intergenic
1016095861 6:140036356-140036378 CTAGACTCTGAGGGTTTTTGGGG - Intergenic
1016383989 6:143513355-143513377 TCAGACTGTGAGCTTTTTGAGGG + Intergenic
1017760085 6:157561979-157562001 TTAGTATCTGAGGTTTTTGTGGG + Intronic
1017930533 6:158950115-158950137 CTAGAGTGTGAGCTTCATGTGGG + Intergenic
1018279315 6:162167787-162167809 CTAGACTTTGAGGTTTGTAAAGG + Intronic
1018644512 6:165935055-165935077 CTAGACTGTGAACTTCTTGGGGG - Intronic
1020675626 7:11181733-11181755 CCAGACCGTGAGCTGTTTGTGGG - Intergenic
1020820715 7:12963926-12963948 CTAGTCTGTGAGTTGTTTGAGGG + Intergenic
1021159673 7:17257236-17257258 TTTGAATGTGAGGTGTTTGTGGG + Intergenic
1022881893 7:34596215-34596237 CTAGACTGTGAGCTCCTTGAGGG + Intergenic
1026569846 7:71520065-71520087 ATAGACTGTGAGCTCTTTGAGGG - Intronic
1027171216 7:75874112-75874134 CCAGACTGTGAGCTTCTTGAGGG - Intronic
1027889786 7:83957077-83957099 CTAGACTGTGAGCTCCTTGAGGG - Exonic
1028094601 7:86744606-86744628 CTACAATGTGAGGTTAGTGTGGG + Intronic
1028680469 7:93523431-93523453 CTGGACTGTGAGGTTATCGAGGG + Intronic
1029842678 7:103383089-103383111 CTAGATTGTGAGCATCTTGTTGG - Intronic
1030148389 7:106379047-106379069 CTAGACTGTGAGCTCTTTAACGG + Intergenic
1030264870 7:107609595-107609617 CTATATTGTGAGGTCTGTGTAGG - Intronic
1030649980 7:112107135-112107157 TTAGATTGTGAGGTATTTGAAGG - Intronic
1032332182 7:130990809-130990831 CTAGACTGTCAGGTCTCTGAGGG + Intergenic
1032622811 7:133554791-133554813 CTAGACTGTGAGATCCTTATGGG + Intronic
1033225502 7:139559328-139559350 CAAGAATGTTAGGGTTTTGTAGG + Intergenic
1033478083 7:141710193-141710215 CTAGACTGTAAGCTCTTTGAGGG - Intronic
1033520028 7:142151115-142151137 CTGGACTGTAAGCTTTTTGAGGG + Intronic
1034389975 7:150778554-150778576 CTAGAAGGTGAGGTGTGTGTGGG - Intergenic
1036710192 8:11073378-11073400 AAAGACTGTGAGGTCTTTGGAGG - Intronic
1036999211 8:13697747-13697769 TTAGACTGTGCGTTTTTTTTAGG + Intergenic
1037741624 8:21613261-21613283 CTAGACAGTGAGCTTCTTATGGG - Intergenic
1038359047 8:26859528-26859550 CTAGACTGTGAGGCCCTTGAGGG + Intronic
1038670826 8:29581510-29581532 CTAGTCTGTGATATTTTTTTAGG - Intergenic
1039376531 8:37040132-37040154 CTAAACTGGGAGGTTTCTTTAGG - Intergenic
1042508202 8:69583750-69583772 CTAGACTGTAAGCTTTTTGAGGG - Intronic
1042583039 8:70303628-70303650 CTAGACTGTGAGCTGTTTGAGGG + Intronic
1043291593 8:78608474-78608496 CTTGAGTGTGAGCTTTTTGAGGG + Intergenic
1043312869 8:78884372-78884394 CTTGGCTGAGAGATTTTTGTGGG - Intergenic
1043586550 8:81776917-81776939 CTAGATTGTGAGGTTCTTGAGGG + Intergenic
1045115484 8:98975234-98975256 CTAGACTGTAAGCTTCTTGTGGG + Intergenic
1045700092 8:104856238-104856260 CTAGACTGTGAGGTCCTTGGTGG - Intronic
1046310382 8:112428574-112428596 CTAGCCTGTGAAATTTTTGAAGG - Intronic
1046550900 8:115714986-115715008 CTAGACTGTAAGCTCTGTGTAGG + Intronic
1046657591 8:116912530-116912552 CTGGCCTTTGAGATTTTTGTGGG + Intergenic
1047314905 8:123723796-123723818 CTAGACTGTAAGACTTTTGGAGG + Intronic
1047719645 8:127627625-127627647 CTAGGCTGTGAGATCTTTGAGGG + Intergenic
1048019421 8:130524829-130524851 CTTGACTCTCAAGTTTTTGTCGG - Intergenic
1050383380 9:5056585-5056607 GTAGACTGTGAGCCTTTTGAAGG + Intronic
1050406062 9:5309735-5309757 CTAGACTGTGAGCTCTTTGGGGG + Intergenic
1052276855 9:26686484-26686506 CTAGACTGTGAAGTTCTTTCAGG - Intergenic
1052382892 9:27790360-27790382 CTAGACTGTGAGTTTTTTGAGGG + Intergenic
1052892892 9:33720197-33720219 CCAGACTGGGAGGTGTTTTTGGG + Intergenic
1052984975 9:34480235-34480257 ATATACTGTGGGATTTTTGTTGG + Intronic
1053153271 9:35756481-35756503 CTCAACTGTGAGTTTTTTCTTGG - Exonic
1056808858 9:89748965-89748987 CTTGACTGTGAAGGTTTTCTTGG - Intergenic
1058158896 9:101545860-101545882 CTAAACTGTGATGTCCTTGTTGG + Intronic
1060096393 9:120794188-120794210 CTAGCTTGTGGGGTTGTTGTGGG - Intergenic
1060286162 9:122254762-122254784 CTAGAATGTGAGGTTCTTGAAGG - Intronic
1060347747 9:122831465-122831487 CGCTACTGTAAGGTTTTTGTTGG + Intergenic
1060428046 9:123522986-123523008 CTAGACTGTGAGCTTTTGGAAGG - Intronic
1060438475 9:123616685-123616707 CAAGACTGTGAGGTGTTTTGTGG + Intronic
1060475946 9:123986759-123986781 CTAGACTATGAGCCTTTTGAGGG + Intergenic
1060513796 9:124253263-124253285 CTAGACAGTGTGTTTTGTGTGGG - Intergenic
1061468838 9:130806285-130806307 CCAGACTGTGAGCTCCTTGTGGG - Intronic
1061553240 9:131349984-131350006 CTAGACCGTGAGCTTGTTGGGGG - Intergenic
1062155803 9:135047476-135047498 CTAGAATATGAGCTTTTTTTTGG + Intergenic
1186721211 X:12306311-12306333 ATAGACTGTGAGATCTTTGAGGG + Intronic
1187027305 X:15448919-15448941 CTAGACTGTGAGCATTTTTGAGG + Intronic
1187960377 X:24562054-24562076 CTAGACGCTAAGGTTTGTGTAGG + Exonic
1187995433 X:24921295-24921317 CTACACTGAGAGGTCTTTGATGG - Intronic
1188708240 X:33361852-33361874 CTAGATTGTCAGATTGTTGTTGG - Intergenic
1189547460 X:42056579-42056601 CTAGACTGCGAGCTTTTTGTTGG + Intergenic
1190908232 X:54749255-54749277 TTAGACTGTGAGATCTTTGAGGG - Exonic
1192215548 X:69155759-69155781 CTAGACTGTCAGCTTTTTGAGGG + Intergenic
1192330954 X:70174835-70174857 CTGGACTGTGAGTTTCTTGAGGG + Intergenic
1192655450 X:72988604-72988626 CTAGGCTGTGAGCTCCTTGTGGG - Intergenic
1194276858 X:91895658-91895680 CTGGACTGTTAGGTTTCTTTGGG - Intronic
1194299643 X:92169850-92169872 CAAGACTGTGAGGTCCTTGGAGG - Intronic
1195320288 X:103716255-103716277 CTAGACTGTGAGCTCTTCGATGG + Intronic
1195715128 X:107811103-107811125 GAAGACTGTGAGGTATTTGATGG - Intergenic
1196081371 X:111636673-111636695 CTCTACTGTAAGGTTTTGGTTGG + Intergenic
1196266482 X:113653503-113653525 CTATACTGTGAGAATCTTGTGGG - Intergenic
1196668683 X:118343622-118343644 CTAGATTATTAGCTTTTTGTAGG + Intergenic
1197276432 X:124484871-124484893 CTACACTGTGAGCTCTTTGCAGG + Intronic
1197610794 X:128635905-128635927 CTAGAAGATGAGGTTTTGGTGGG + Intergenic
1197920816 X:131591819-131591841 CTAGACTGTTAGTTCTTTGAGGG - Intergenic
1198450849 X:136766372-136766394 CTATTTTGTGAGGTTTTTTTTGG + Intronic
1199158734 X:144582062-144582084 GGAGACTGTGGGGTTTTTCTAGG + Intergenic
1199902374 X:152189102-152189124 CTAGACTGTGAACATTTTGAGGG - Intronic
1200594210 Y:5117769-5117791 CTGGACTGTTAGGTTTCTTTGGG - Intronic
1200617287 Y:5395011-5395033 CAAGACTGTGAGGTCCTTGGAGG - Intronic
1200915074 Y:8564409-8564431 TGAGACTGTGAGGTGTTTGCTGG - Intergenic
1201645461 Y:16224780-16224802 CTTCACAGTGAGGTTTTAGTGGG + Intergenic
1201657352 Y:16360532-16360554 CTTCACAGTGAGGTTTTAGTGGG - Intergenic
1202125775 Y:21567780-21567802 CAAGACTGTGAGGTGATTGCTGG - Intergenic