ID: 1146132685

View in Genome Browser
Species Human (GRCh38)
Location 17:30292135-30292157
Sequence GGCCGCGCCTGCCCCCGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 394}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146132680_1146132685 -2 Left 1146132680 17:30292114-30292136 CCGCCAGCGCCCGGGGGCTGAGG 0: 1
1: 0
2: 3
3: 35
4: 338
Right 1146132685 17:30292135-30292157 GGCCGCGCCTGCCCCCGCGCAGG 0: 1
1: 0
2: 3
3: 34
4: 394
1146132672_1146132685 30 Left 1146132672 17:30292082-30292104 CCGACGGGGGCGGCCTAGCTGAC 0: 1
1: 0
2: 0
3: 4
4: 23
Right 1146132685 17:30292135-30292157 GGCCGCGCCTGCCCCCGCGCAGG 0: 1
1: 0
2: 3
3: 34
4: 394
1146132682_1146132685 -5 Left 1146132682 17:30292117-30292139 CCAGCGCCCGGGGGCTGAGGCCG 0: 1
1: 0
2: 1
3: 27
4: 312
Right 1146132685 17:30292135-30292157 GGCCGCGCCTGCCCCCGCGCAGG 0: 1
1: 0
2: 3
3: 34
4: 394
1146132675_1146132685 17 Left 1146132675 17:30292095-30292117 CCTAGCTGACGCGCTGGGTCCGC 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1146132685 17:30292135-30292157 GGCCGCGCCTGCCCCCGCGCAGG 0: 1
1: 0
2: 3
3: 34
4: 394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146132685 Original CRISPR GGCCGCGCCTGCCCCCGCGC AGG Intergenic