ID: 1146132753

View in Genome Browser
Species Human (GRCh38)
Location 17:30292346-30292368
Sequence GCCAAAAGGGAGCTCGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146132746_1146132753 -3 Left 1146132746 17:30292326-30292348 CCCAGGAAGCCTTGTGAGAAGCC No data
Right 1146132753 17:30292346-30292368 GCCAAAAGGGAGCTCGAGGCGGG No data
1146132743_1146132753 24 Left 1146132743 17:30292299-30292321 CCAGTACTCTAGCATCGGGGAAT No data
Right 1146132753 17:30292346-30292368 GCCAAAAGGGAGCTCGAGGCGGG No data
1146132741_1146132753 26 Left 1146132741 17:30292297-30292319 CCCCAGTACTCTAGCATCGGGGA No data
Right 1146132753 17:30292346-30292368 GCCAAAAGGGAGCTCGAGGCGGG No data
1146132745_1146132753 -2 Left 1146132745 17:30292325-30292347 CCCCAGGAAGCCTTGTGAGAAGC No data
Right 1146132753 17:30292346-30292368 GCCAAAAGGGAGCTCGAGGCGGG No data
1146132742_1146132753 25 Left 1146132742 17:30292298-30292320 CCCAGTACTCTAGCATCGGGGAA No data
Right 1146132753 17:30292346-30292368 GCCAAAAGGGAGCTCGAGGCGGG No data
1146132747_1146132753 -4 Left 1146132747 17:30292327-30292349 CCAGGAAGCCTTGTGAGAAGCCA No data
Right 1146132753 17:30292346-30292368 GCCAAAAGGGAGCTCGAGGCGGG No data
1146132739_1146132753 27 Left 1146132739 17:30292296-30292318 CCCCCAGTACTCTAGCATCGGGG No data
Right 1146132753 17:30292346-30292368 GCCAAAAGGGAGCTCGAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146132753 Original CRISPR GCCAAAAGGGAGCTCGAGGC GGG Intergenic
No off target data available for this crispr