ID: 1146134963

View in Genome Browser
Species Human (GRCh38)
Location 17:30311585-30311607
Sequence CTGTATATGTACATATATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146134961_1146134963 -8 Left 1146134961 17:30311570-30311592 CCATTATATATATATCTGTATAT No data
Right 1146134963 17:30311585-30311607 CTGTATATGTACATATATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146134963 Original CRISPR CTGTATATGTACATATATGT GGG Intergenic
No off target data available for this crispr