ID: 1146135469

View in Genome Browser
Species Human (GRCh38)
Location 17:30317061-30317083
Sequence GTTCAAAGGAGAATAGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 291}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146135469_1146135478 8 Left 1146135469 17:30317061-30317083 CCACCTTCTATTCTCCTTTGAAC 0: 1
1: 0
2: 2
3: 23
4: 291
Right 1146135478 17:30317092-30317114 CTTCCAGCACCTCCCATCTCTGG 0: 1
1: 0
2: 3
3: 31
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146135469 Original CRISPR GTTCAAAGGAGAATAGAAGG TGG (reversed) Intronic
901878899 1:12182430-12182452 GTTCAATAGAGAATTCAAGGTGG - Intronic
902146172 1:14401093-14401115 TTTCAAAGGGGATAAGAAGGGGG + Intergenic
902270819 1:15303329-15303351 GTTCAGATGAGAAGAGAAAGAGG - Intronic
903866284 1:26400704-26400726 ATTGAAAGGAGTATACAAGGAGG + Intergenic
904367276 1:30022196-30022218 GTTCAATGTTGAATAGAAGTGGG + Intergenic
905014043 1:34764945-34764967 GATCATGGGAGAATAGCAGGAGG - Intronic
905036858 1:34924310-34924332 GTGCCATGGAGAAGAGAAGGGGG - Intronic
905236077 1:36549573-36549595 GGTCAAAGGAGAAATGAAAGGGG - Intergenic
906057154 1:42926395-42926417 GTGCAAAGGAGACTAGAACCCGG + Exonic
908595962 1:65689198-65689220 AGTCAAAGGAGAAAAGGAGGAGG + Intergenic
909375495 1:74936938-74936960 GTACAAAGGAGAAATGTAGGAGG - Intergenic
909482369 1:76139881-76139903 GTTCAAAGTAGAATAGGATGGGG + Intronic
910031417 1:82729541-82729563 GTTCAAAGAAGAATAAAAACTGG + Intergenic
910175575 1:84426910-84426932 GTTTAAAGCAGAATTGAAGGAGG + Intergenic
910743682 1:90550043-90550065 GTTCAAAGGAGTATAAATGCTGG - Intergenic
911354239 1:96796787-96796809 AGTCAAGGGAGAATAGAAAGGGG + Intronic
913605873 1:120465305-120465327 GATCAAAGAAGAAAAGAAGAAGG + Intergenic
914082682 1:144423911-144423933 GATCAAAGAAGAAAAGAAGAAGG - Exonic
914177586 1:145292425-145292447 GATCAAAGAAGAAAAGAAGAAGG - Exonic
914367079 1:146988883-146988905 GATCAAAGAAGAAAAGAAGAAGG + Exonic
914367615 1:146993641-146993663 GATCAAAGAAGAAAAGAAGAAGG + Exonic
914485368 1:148104581-148104603 GATCAAAGAAGAAAAGAAGAAGG - Exonic
914585694 1:149059744-149059766 GATCAAAGAAGAAAAGAAGAAGG - Exonic
915396690 1:155590485-155590507 GTCAAAAGAAAAATAGAAGGAGG + Intergenic
915541682 1:156571215-156571237 TTTCTAAGGAGAATAGAGAGAGG - Intronic
916255582 1:162784193-162784215 GAGTAAAGGAGAATAGAAGAAGG + Exonic
916524813 1:165599574-165599596 CTTCAAAAGAGAAGGGAAGGGGG - Intergenic
918085090 1:181238286-181238308 GGTCAAAGCAGGACAGAAGGTGG + Intergenic
918730366 1:187985765-187985787 GTCCAAAGCAAAATAGCAGGGGG - Intergenic
919462925 1:197900454-197900476 GATCAAATGAAAATTGAAGGGGG + Intergenic
920517903 1:206600061-206600083 GGTCAAAGGAGAAAGGAAAGTGG + Intronic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
920643684 1:207779854-207779876 GTTCAAAGGAGAAAAGAGGATGG - Intronic
921482400 1:215678114-215678136 TTTCAAGGTAGAATTGAAGGTGG - Intronic
923012960 1:230103645-230103667 GTTCTAAGGAGACAAGTAGGTGG + Intronic
923417332 1:233776188-233776210 GTACAAAGGAGGAGAGATGGAGG + Intergenic
1063100847 10:2948899-2948921 CTTGAAAGGAGAATTAAAGGTGG - Intergenic
1063573088 10:7234874-7234896 GTTCAAGGGAGATGAGCAGGAGG + Intronic
1063663701 10:8049907-8049929 GTTCAAAGGAGAGAAGCCGGAGG - Intergenic
1065003339 10:21357137-21357159 CCTATAAGGAGAATAGAAGGAGG - Intergenic
1065038731 10:21668295-21668317 GGTAAAAGGAGACCAGAAGGAGG - Intronic
1065338061 10:24675301-24675323 GATCAAAGAAGAAGAGGAGGAGG + Intronic
1066242335 10:33550370-33550392 GCTCAAAGAAGAATAGTAGAAGG - Intergenic
1066446645 10:35490146-35490168 GTTCAGAGGAAAAGAGCAGGTGG - Intronic
1066722045 10:38349854-38349876 GAGTAAAGGAGAATAGAAGAAGG + Intergenic
1067835624 10:49638704-49638726 AAACAAAGGAGAATAAAAGGTGG - Intronic
1068558243 10:58482148-58482170 GTTGAAAGGTGGAAAGAAGGAGG - Intergenic
1071096713 10:81983983-81984005 GTTCAAAGAAGAAGAGAAGGTGG + Intronic
1072450344 10:95534494-95534516 GATAAAAGGAGACTGGAAGGAGG + Intronic
1072557704 10:96535665-96535687 GTTCAGAGGAGAATGAAAGCAGG + Intronic
1073293161 10:102423309-102423331 GAGCAAAGGAGTAGAGAAGGGGG + Exonic
1074021058 10:109583580-109583602 GCTCACAGGAGAAAAGAAGAAGG + Intergenic
1074189307 10:111122325-111122347 GCTAAAAGGAGATCAGAAGGTGG - Intergenic
1074280284 10:112045095-112045117 GTTGAAAGGAAAAAAGAAAGAGG - Intergenic
1074404225 10:113166985-113167007 GTTCAAAGGGGAAACGAAGATGG - Exonic
1074709744 10:116167342-116167364 GTTCCAAGGAGAAAATACGGAGG - Intronic
1074854568 10:117464093-117464115 ATGCAAAGGAGAATTGAATGGGG - Intergenic
1076334322 10:129694784-129694806 GCTCAAAGGAGAAAGGGAGGGGG + Intronic
1077359036 11:2132460-2132482 GTCCAAGGGAGAAGAGAAAGAGG + Intronic
1078158706 11:8821216-8821238 GTTCTAAGGAGAAAAGAGGGTGG + Intronic
1079985469 11:27196279-27196301 GTTCAGATGAGAATAGGGGGAGG - Intergenic
1080026144 11:27617070-27617092 GGTAAGAGGAGAATAGAAGATGG - Intergenic
1080130029 11:28783081-28783103 AATCAAAGGAGACTAGAAAGTGG + Intergenic
1080443426 11:32315688-32315710 GGTCAAAGGTGAATAGCAGGAGG - Intergenic
1080941666 11:36925296-36925318 GTTTAAGGGAGACTAGAAGAAGG - Intergenic
1081718425 11:45267978-45268000 GGGAAAAGGAGAATAGGAGGAGG - Intronic
1085601127 11:77856901-77856923 GTTGAAAACAGAATACAAGGTGG + Intronic
1086749318 11:90470897-90470919 GTTCATAGGAGAATATATGTGGG + Intergenic
1087154575 11:94887810-94887832 GTTCAAAGGAGATAAGAAAAAGG - Intergenic
1088000538 11:104875122-104875144 GTGCAGATGAGAATAAAAGGGGG + Intergenic
1088395941 11:109369699-109369721 CTTCAAAAGAGAAGAAAAGGAGG - Intergenic
1090070250 11:123538087-123538109 GTCCCAAGAAGAATAGAAAGAGG - Intronic
1091023378 11:132121080-132121102 GTTCACAGGAGAAAAGTAGAAGG + Intronic
1091159499 11:133407046-133407068 GTTCAAAGGCGAATAAAGGTTGG - Intronic
1091493937 12:956076-956098 GTTCAAGGGAGTATAGGAAGGGG - Intronic
1093218703 12:16393066-16393088 GTTAAAATGAGAATAGACAGTGG + Intronic
1093942082 12:25066237-25066259 GTTAAAATGTGAATAGAAGCGGG + Intronic
1094706493 12:32919271-32919293 CTTCAGAGGAGAAAAGAAGCCGG - Intergenic
1096385053 12:51189826-51189848 GAGCAAAGGAGAAGACAAGGTGG + Exonic
1097057114 12:56256982-56257004 TTTGAAAGGGTAATAGAAGGTGG + Intronic
1097759010 12:63438914-63438936 TTTCACATAAGAATAGAAGGTGG - Intergenic
1100164648 12:91902542-91902564 ATTAAAAGGAAAATAAAAGGTGG - Intergenic
1100245479 12:92752661-92752683 AATGAAAGGAGAATGGAAGGTGG + Intronic
1103175222 12:118857668-118857690 GTTCAAAGGAGGTGGGAAGGAGG + Intergenic
1103562024 12:121797807-121797829 GTTTCAGGGAGTATAGAAGGAGG + Intronic
1104322995 12:127769784-127769806 GTTCAAAGGAGAAAATGAGGAGG + Intergenic
1105059697 12:133137580-133137602 GCTCACAGGAGCATAGAAGGTGG - Intronic
1105283745 13:18986853-18986875 GATCAGAGCAGAATTGAAGGAGG + Intergenic
1107622888 13:42251689-42251711 GTTCACAGGTGAATACGAGGTGG - Intronic
1108446231 13:50511565-50511587 GTTCAAAAGAGGATGGAAGGAGG + Intronic
1109717776 13:66239167-66239189 GTTCACAGGAGAAAAGATTGGGG - Intergenic
1110719208 13:78742624-78742646 GTTCAAAGAAGGAAAGAAAGAGG - Intergenic
1111092485 13:83464965-83464987 GATCAGAGAAGAATTGAAGGAGG + Intergenic
1112509070 13:99992177-99992199 TTTCACAGGAAAATACAAGGAGG - Intergenic
1112522985 13:100114593-100114615 GTCCAAAGGAAAATAAAAAGGGG + Intronic
1112901298 13:104361099-104361121 GTACACAGAAGAATAGAATGTGG - Intergenic
1113372978 13:109739461-109739483 TTCAAAAGGAGAAAAGAAGGTGG - Intergenic
1113613320 13:111663427-111663449 ATTCCAAGGAGAAGAGGAGGAGG - Intronic
1114191535 14:20442947-20442969 GTTCCAGGGAGAATAGGAGAGGG + Intergenic
1114715728 14:24821958-24821980 GTGCAAAGGAGAAGAGAGTGAGG - Intronic
1116631693 14:47343347-47343369 GCTCAAAGGAGGACAGAAAGTGG + Intronic
1117225457 14:53653871-53653893 CTCCAAAGGAGAATAGGAAGAGG + Intergenic
1118203596 14:63700821-63700843 GTTCAAAGGAAGATTGAAAGTGG - Intronic
1119730787 14:76949810-76949832 GTTCAAATAAGAACAGAAGGTGG - Intergenic
1123163967 14:106308072-106308094 TTTCAAAGAAGAAGGGAAGGTGG + Intergenic
1124076803 15:26453932-26453954 GTTCAAGGGAGGACAGGAGGAGG + Intergenic
1125143412 15:36437164-36437186 GTTTTAAGGAGAAAAGCAGGGGG + Intergenic
1125157673 15:36607353-36607375 GTTCACAGGAGAATACGAGGAGG + Intronic
1131313983 15:91316438-91316460 TTTCAAAGGAGAATAGAAAGAGG - Intergenic
1131803357 15:96095762-96095784 GTTTATAGGAAAATAGAAGAAGG + Intergenic
1132940818 16:2507225-2507247 GTTCAGAGGAGCAAAGAAAGAGG - Intronic
1133078660 16:3300541-3300563 GTTCTAAGTAGAATTGAAGCTGG - Exonic
1133892344 16:9892424-9892446 GGCCAAAGAAGAAGAGAAGGAGG + Intronic
1135153047 16:20026700-20026722 GGACAAAGGAGAGTTGAAGGAGG - Intergenic
1136044444 16:27604044-27604066 GTGCTATGGAGAATAGAAAGTGG - Intronic
1137499495 16:48999399-48999421 GTCCAAAGGAGAAAAGAAGCTGG - Intergenic
1138273131 16:55710309-55710331 GGTCAAAGGCGACTACAAGGAGG - Intergenic
1138594525 16:58022734-58022756 CCTCAATGGAGAATGGAAGGTGG + Intergenic
1138761278 16:59547642-59547664 GTTGAATGGAGGAAAGAAGGAGG - Intergenic
1139218065 16:65148933-65148955 GTACAAGAGAGAATAGAAAGGGG + Intergenic
1140961768 16:79919832-79919854 GTTGAGAGGAGAATAGTGGGAGG - Intergenic
1140989149 16:80191452-80191474 CTTAAAAGGTGAAAAGAAGGAGG + Intergenic
1143799081 17:9363106-9363128 CTTCAAAGGAGTATGGAAAGAGG + Intronic
1144282346 17:13738711-13738733 ATTCAAAGGAAAATAGAAATTGG + Intergenic
1144292116 17:13836987-13837009 TTTGAAAGGTGAAGAGAAGGAGG + Intergenic
1145095760 17:20024686-20024708 GTGCAAAGCAGAAAACAAGGGGG - Intronic
1145726221 17:27128245-27128267 GTTCAAAGAAAATTTGAAGGAGG + Intergenic
1146135469 17:30317061-30317083 GTTCAAAGGAGAATAGAAGGTGG - Intronic
1146963344 17:37003800-37003822 GTTCAAGAGAGAATGGGAGGAGG + Intronic
1147732368 17:42611987-42612009 GTTATAAGGAGAATTGAGGGTGG + Intronic
1149045369 17:52238724-52238746 GTTTAAAGTAGAATTAAAGGGGG - Intergenic
1151210366 17:72539888-72539910 ATTTAAAAGAGAAAAGAAGGAGG - Intergenic
1151519371 17:74617295-74617317 GACCAAGGGAGAAGAGAAGGTGG - Exonic
1153011529 18:544002-544024 GTTCCAAAAAGAATAAAAGGAGG - Intergenic
1153390165 18:4548274-4548296 ATTCAAAGTACAATAGAAGATGG + Intergenic
1153439896 18:5104576-5104598 CTTCAAAGGAGAAGAAAAGATGG - Intergenic
1156311269 18:35924268-35924290 GCACAAAAGAGAAGAGAAGGAGG - Intergenic
1156934540 18:42687580-42687602 TTTAAAAGGAGTAGAGAAGGAGG - Intergenic
1158371990 18:56817365-56817387 ATTAAAAGGAGAAAAGAAAGGGG + Intronic
1158391185 18:57046536-57046558 GCCCAAAGGAGGAAAGAAGGAGG - Intergenic
1160044113 18:75371013-75371035 GGTCAAAGAAGAATGGAAGTGGG - Intergenic
1161972392 19:7589986-7590008 ACACCAAGGAGAATAGAAGGAGG - Intergenic
1162410767 19:10503548-10503570 GTTAAAAGGAGAATAGCAGATGG - Exonic
1163495268 19:17642880-17642902 GATCAAAGGCGAGGAGAAGGTGG - Exonic
1163835862 19:19573485-19573507 TTTCAAGGTAGAATAGATGGCGG + Intronic
1164234984 19:23323926-23323948 GAGGAAAGGAGAAGAGAAGGAGG - Intronic
1164250199 19:23469113-23469135 GATGAGAGGAGAAGAGAAGGAGG - Intergenic
1164784643 19:30920383-30920405 TTTGAAAGGAAAATAGGAGGAGG + Intergenic
1166333176 19:42090403-42090425 CTTCAAAGGGGAAAAGAGGGAGG + Exonic
928286600 2:29995451-29995473 ATGCAAAGGAGAAGAGATGGGGG + Intergenic
928535477 2:32236000-32236022 CTTCAAAGGAGGAAAGCAGGTGG + Intronic
929894146 2:45943997-45944019 GTTCAAAGGCAGATAGATGGTGG + Intronic
930711287 2:54553209-54553231 GTTTTAGGGAGAAAAGAAGGTGG + Intronic
930906231 2:56571875-56571897 GGTGAAAGAATAATAGAAGGAGG + Intergenic
931138025 2:59426497-59426519 GTTCACAGGACAAAAGAAGAGGG - Intergenic
931230108 2:60366844-60366866 GTTCAATGGAGAAAACAAAGGGG + Intergenic
931856479 2:66307243-66307265 TTTAAAAGGAGAAGAGGAGGAGG + Intergenic
933156625 2:78982589-78982611 TTTCAAAGGAGAGCAGAAGGAGG - Intergenic
933313951 2:80693598-80693620 ATGCCAAGAAGAATAGAAGGAGG + Intergenic
934714191 2:96533828-96533850 TTTCAAAGGAGAAATGAAGTGGG - Intergenic
936482105 2:112893467-112893489 GTCCACAGGAGAAGAGATGGTGG + Intergenic
937660835 2:124428158-124428180 GGGAATAGGAGAATAGAAGGAGG - Intronic
938578505 2:132625565-132625587 GCTCATATGAGAACAGAAGGGGG + Intronic
942103069 2:172605233-172605255 GTTCATAGTGGAATAGAAGGAGG - Intronic
944171740 2:196786778-196786800 GTTAAAAAGAGAATGGAAAGAGG - Intronic
945945508 2:215991538-215991560 GATCAGAGCAGAATTGAAGGAGG + Intronic
947968354 2:234301366-234301388 CTTCAAAGGAAAACAGAGGGAGG - Intergenic
1169882964 20:10367305-10367327 GTTTAAGGGAGAATGGAATGAGG - Intergenic
1170852885 20:20020265-20020287 TTACAAAGGAAAATAGAAGCAGG + Intronic
1174320301 20:49736441-49736463 GTTCAATGGAGAACAAAAGTGGG - Intergenic
1175316111 20:58047814-58047836 GTTCAAGGGAGAAAGAAAGGAGG - Intergenic
1177895104 21:26847293-26847315 GTTCGAAGTCGAAGAGAAGGAGG - Intergenic
1180850941 22:19019841-19019863 GTTCCCAGGAGAAGAGTAGGAGG - Intergenic
1181937863 22:26451444-26451466 GATCAAAGGAGGAAAGAAAGGGG + Intronic
1183528049 22:38336018-38336040 GGTCAAAGGAGAGGAGGAGGAGG - Intronic
949718587 3:6962428-6962450 GTCAAAAGGAGAAAAAAAGGTGG + Intronic
950543493 3:13625799-13625821 GTTCCAAGCAGAAGAGAAAGTGG - Intronic
951557435 3:23934999-23935021 GTACAAAGGGAAATAGAGGGTGG - Intronic
951814686 3:26741178-26741200 ATTCAAATAAGAATAGAATGGGG - Intergenic
952215315 3:31272312-31272334 TTTCAAAGAAGAAAAGGAGGAGG + Intergenic
952690187 3:36196388-36196410 CCTCAAATGAGAAGAGAAGGAGG - Intergenic
956068717 3:65424615-65424637 CTTCCAAGGAGAATAGAAAGGGG - Intronic
956927941 3:74009609-74009631 GGTCACAGGAGAACAGAGGGTGG + Intergenic
957154430 3:76529792-76529814 CTGCAAGGGAGAATAGAAGAGGG - Intronic
957381166 3:79431529-79431551 TTTCAAAAGAGAATAAAAGGTGG + Intronic
957489731 3:80908157-80908179 GATCAGAGCAGAATTGAAGGCGG + Intergenic
957693822 3:83607314-83607336 GGTCAAAAGAGAACAGAAGAGGG + Intergenic
960233751 3:115257793-115257815 GATCAGAGCAGAATTGAAGGAGG + Intergenic
960249306 3:115434755-115434777 ATTCAAAGGTGGATAAAAGGAGG + Intergenic
960324122 3:116274136-116274158 GTTCAAAGGCAGTTAGAAGGTGG - Intronic
960524114 3:118690096-118690118 GATCAAAGGATAAATGAAGGAGG - Intergenic
960584031 3:119304256-119304278 GTACAAAGAAGAATGGAATGAGG + Intronic
962436466 3:135371651-135371673 GTTTAAAGGGCAATAGGAGGAGG - Intergenic
963575035 3:147049635-147049657 GTTGTAAGGAGAATAAAATGAGG + Intergenic
965186341 3:165469338-165469360 GTACACAGAAGAATAGAAGGTGG + Intergenic
965327728 3:167328622-167328644 AATGAAAGGAGAATGGAAGGAGG - Intronic
965421431 3:168463883-168463905 GTTCAAAGGAGAAATAAATGTGG + Intergenic
965451741 3:168846339-168846361 GTAGAAAGAAGAACAGAAGGAGG - Intergenic
965451752 3:168846407-168846429 GTAGAAAGAAGAACAGAAGGAGG - Intergenic
967148704 3:186628526-186628548 CTCCCAAGGAGAAAAGAAGGGGG - Intergenic
968708441 4:2095116-2095138 GTCCAAGGGAGAGTAGAAGAAGG + Intronic
968949533 4:3683453-3683475 GTCCCAAGGAGAATGGGAGGTGG - Intergenic
970041320 4:11800105-11800127 TTTCAAAGGAGGAAAGAAGAAGG - Intergenic
970578561 4:17451806-17451828 GAACAGAGGAGACTAGAAGGTGG - Intergenic
970649061 4:18157683-18157705 AGACAAAGGAGAATAGAAGTGGG + Intergenic
973771162 4:54208264-54208286 ATTCAAATGAGAGCAGAAGGAGG - Intronic
974785288 4:66611545-66611567 GTTCCAAGGAGAATATACGAAGG - Intergenic
976399876 4:84595527-84595549 ATTCAAAGGGGAAAAAAAGGTGG - Intronic
976554466 4:86433767-86433789 GTTCAAGGGAGCATTGAAGGAGG + Intronic
978279621 4:106994762-106994784 CTTCAAAGGAGAGCAGCAGGGGG - Intronic
978826827 4:113034580-113034602 GTAGAAAGGAGAAGAGAAGCTGG + Intronic
978951550 4:114565978-114566000 CACCAAAGCAGAATAGAAGGAGG - Intergenic
979000175 4:115207531-115207553 GGTAAAAGGAAAATAGAGGGAGG + Intergenic
979429568 4:120612382-120612404 GTTCAAAGCAGAAAAAAAGATGG - Intergenic
979632909 4:122923147-122923169 CTTCCAAGAAGAATAGAAAGCGG + Exonic
980003750 4:127517703-127517725 CTTCAAAGGACAATAGACGGTGG - Intergenic
980502078 4:133669027-133669049 TTTCAAAAGAAAATAGGAGGAGG - Intergenic
981352026 4:143742328-143742350 AATAGAAGGAGAATAGAAGGAGG + Intergenic
982176352 4:152709001-152709023 GTTGAAAGGAGAAGAAAGGGCGG + Intronic
983160467 4:164407606-164407628 GTTCAGGAGAGAATAGAAGATGG - Intergenic
983162588 4:164434930-164434952 GGTTAAAGCAGAAGAGAAGGAGG + Intergenic
983832564 4:172346503-172346525 ATTCAAGTGAGAATTGAAGGTGG - Intronic
985208465 4:187566393-187566415 ATTGAAAGGAGGAAAGAAGGGGG - Intergenic
985871942 5:2564126-2564148 ACTCAAAGGAGAGGAGAAGGAGG - Intergenic
986854606 5:11854071-11854093 GCTGGAAGGAGAATAGAGGGAGG - Intronic
987399539 5:17460995-17461017 GATCAGAGAAGAATTGAAGGTGG - Intergenic
987713057 5:21528989-21529011 TTTCAAAAGAGAAGAGAAGAGGG - Intergenic
987793151 5:22594324-22594346 ATTCAATGGAGAACACAAGGGGG - Intronic
989690123 5:44132040-44132062 TTTGAAAAAAGAATAGAAGGAGG - Intergenic
990938804 5:61179220-61179242 GTCAAAAGGAGAATAAAAGTAGG - Intergenic
991255434 5:64608276-64608298 GTGCAAAGCAAAAGAGAAGGTGG - Intronic
993481859 5:88433690-88433712 GTTCAACAGAGAAGAAAAGGAGG - Intergenic
994493463 5:100478467-100478489 TAACAAAGGAGAATGGAAGGAGG - Intergenic
994958876 5:106572071-106572093 GTTCAGAGAATAATTGAAGGTGG + Intergenic
995590290 5:113692797-113692819 GTTAAAAGGAAAAAACAAGGAGG - Intergenic
998874915 5:146589417-146589439 GTTCAAAGGAAAATGGAAAATGG + Intronic
999010976 5:148040218-148040240 TCTCAAAGGAGAATAGTTGGGGG - Intronic
999517366 5:152314599-152314621 GTTCATTGGAGAAAGGAAGGAGG - Intergenic
1003040386 6:2682473-2682495 GTGCTAAGGAGAAGAGAGGGTGG - Intronic
1003089420 6:3089025-3089047 TCTGAAAGGAGAAGAGAAGGAGG - Intronic
1005278963 6:24250289-24250311 GGCCAAAGGAGAAGAGAATGGGG + Intronic
1007199385 6:40093334-40093356 GATCAAAGCAGAACTGAAGGAGG - Intergenic
1008351166 6:50492094-50492116 GTTCAGAAGAGAATTGATGGTGG - Intergenic
1010091030 6:71982172-71982194 CTTCAAAGGATAATAGATGGTGG - Intronic
1010524216 6:76880564-76880586 AAAGAAAGGAGAATAGAAGGTGG + Intergenic
1010709375 6:79154624-79154646 CTTCACAGGACATTAGAAGGGGG - Intergenic
1011419121 6:87153396-87153418 GTGCAAAGGAGAAGAAATGGAGG + Intronic
1012323451 6:97882538-97882560 GCTGAAAGGAGAAAAGAAGCAGG - Intergenic
1012598263 6:101065143-101065165 GATCAGAGCAGAATTGAAGGAGG + Intergenic
1013106636 6:107031410-107031432 GAAAAAAGGAGAAGAGAAGGAGG + Intronic
1018706814 6:166469577-166469599 GGGCAGAGGAGAGTAGAAGGAGG + Intronic
1022287979 7:28973809-28973831 GTTCTAGGGAGAACAGATGGTGG - Intergenic
1023110847 7:36809174-36809196 GTTCAAAGGAGAACAAACAGAGG + Intergenic
1023776574 7:43613540-43613562 GTTAAAAGTAGACTAGAAGAAGG + Intronic
1024331487 7:48159877-48159899 ATTCAAAGAAGGAGAGAAGGAGG - Intergenic
1025714760 7:63944737-63944759 GATCAGAGCAGAATTGAAGGAGG + Intergenic
1025960841 7:66220039-66220061 GGTCAAAGGAAAAAAAAAGGAGG + Intronic
1027178465 7:75920398-75920420 TTTGGTAGGAGAATAGAAGGGGG + Intronic
1027827042 7:83128877-83128899 GTTCAGAGAAGCATAGAAGCTGG - Intronic
1028191779 7:87862173-87862195 GCACATAGGAGAATAGAAAGTGG - Intronic
1029313018 7:99685393-99685415 GTTCCAAGGAAAATATGAGGAGG + Intronic
1030728726 7:112958155-112958177 GTTGAAAGTGGAATAAAAGGTGG - Intergenic
1030824161 7:114134255-114134277 GTTCAAGAGAGAAAGGAAGGAGG + Intronic
1033799118 7:144879832-144879854 GTTCAAAGGGGAAGATAAGTGGG + Intergenic
1033911804 7:146272928-146272950 GACCAAAGGAGAAGTGAAGGAGG + Intronic
1035598412 8:879964-879986 GATCAAATGAGTAAAGAAGGAGG - Intergenic
1035896273 8:3405989-3406011 TTTCAAAGGAGAAGAGCGGGGGG + Intronic
1036984871 8:13518045-13518067 GTGGAAAGAAGAATAGCAGGAGG + Intergenic
1037380073 8:18275713-18275735 ATTCAGAGGAGCATAGAAGAGGG - Intergenic
1037946383 8:22992184-22992206 GGTCAGAGGAGAAGAGATGGGGG + Intronic
1039709146 8:40037921-40037943 GTTCAAAAGAGGAGAGATGGGGG + Intergenic
1041473293 8:58234805-58234827 GTTCAAGGGAGAATGAGAGGTGG + Intergenic
1041593404 8:59618319-59618341 GTTCCAAGGAGGATTTAAGGGGG - Intergenic
1041713224 8:60911566-60911588 GTCCAAAGGAGAAAAGGAAGGGG - Intergenic
1042007683 8:64200297-64200319 GTTCAAGAGAAACTAGAAGGTGG - Intergenic
1043095071 8:75957917-75957939 TTTCAAAGGAGAAAAGAAATTGG - Intergenic
1043528440 8:81122468-81122490 GGCCACAGGAGAATTGAAGGAGG + Intergenic
1044746559 8:95376652-95376674 GTAGAAAGGAAAATAGAATGAGG + Intergenic
1046174054 8:110551788-110551810 GATGAAAAGAGAAGAGAAGGTGG - Intergenic
1046546357 8:115655411-115655433 GTCCAAAGCAGAATAGATGGGGG + Intronic
1047853326 8:128882790-128882812 GTTAAAAGGAGAAGAGTAGTTGG + Intergenic
1048308475 8:133299941-133299963 GTTCAAAGGCGCAGGGAAGGCGG + Intronic
1048655282 8:136529794-136529816 GTTCCATGGAAAAGAGAAGGAGG + Intergenic
1050070514 9:1807804-1807826 GTCCAATGATGAATAGAAGGTGG + Intergenic
1050737319 9:8779037-8779059 GCTCAAAGGGAAAAAGAAGGTGG + Intronic
1052019580 9:23510038-23510060 GCTTAAAGGATAACAGAAGGTGG - Intergenic
1052380535 9:27766357-27766379 GCTCCAGGTAGAATAGAAGGAGG - Intergenic
1052600642 9:30625351-30625373 GTTCTATGGGGAATAGATGGTGG + Intergenic
1052907704 9:33851082-33851104 ATTCAGAGGGGAATAGAAGTGGG - Intronic
1052925045 9:34008380-34008402 GTTCAAAGGGAACCAGAAGGTGG - Intronic
1053144257 9:35701611-35701633 GTACAAAGGAGGATTGGAGGGGG + Intronic
1055737497 9:79347371-79347393 GTTTAAGGGAGAAGAGAAGTGGG - Intergenic
1056716190 9:89031980-89032002 GCTCAAAGGAGAAGAGAGGCTGG - Intronic
1059280278 9:113127005-113127027 GTAACAAGGAGAATAGAAGCAGG + Intergenic
1059882321 9:118705317-118705339 GTGCAAAGTAGAACAGAAGGGGG + Intergenic
1060198139 9:121636317-121636339 GCTAAAAGGAGAATAAAAGCAGG - Intronic
1188343811 X:29039366-29039388 CTTCAAAGAAGAAAAGAAGTAGG - Intronic
1188414192 X:29912553-29912575 GGAGAAAGGAGAAGAGAAGGAGG + Intronic
1190550858 X:51578802-51578824 GATCAAAGAATAATTGAAGGAGG + Intergenic
1191078072 X:56477345-56477367 GTTCAAGAGAGAACAGAAGAAGG - Intergenic
1192054527 X:67759595-67759617 GATGAAAGGAGAAGGGAAGGAGG - Intergenic
1192772548 X:74207798-74207820 GTTCAAAGGCGCAGAGAGGGAGG + Intergenic
1193268578 X:79502757-79502779 GTGCAAAGGAGAATAAAGAGGGG + Intergenic
1194152575 X:90343863-90343885 TTTTAAAGGAAAATGGAAGGAGG - Intergenic
1195727363 X:107932229-107932251 ATTCAAAGGAGAAAAGAATTTGG + Intergenic
1196170686 X:112584968-112584990 GTACAATGTTGAATAGAAGGTGG - Intergenic
1196627195 X:117890011-117890033 GTTCAAGCCAGAATAGAAGGGGG - Intergenic
1197494141 X:127156130-127156152 TTTCAAAGGAAAATAGAAAAAGG - Intergenic
1197620899 X:128746789-128746811 CTTAAAAGGAAAATTGAAGGAGG + Intergenic
1197949633 X:131880563-131880585 GCTCAAAGGCGAAGAGAAGAAGG + Intergenic
1198040246 X:132843891-132843913 ATTCAAAGGACCATAGAAGAGGG + Intronic
1198494717 X:137180387-137180409 TTTAAAAGGAGACAAGAAGGGGG - Intergenic
1199167837 X:144698490-144698512 GTACAAAGTAGCAAAGAAGGAGG - Intergenic
1200174438 X:154103054-154103076 GTTTAAAAGAGAATGGAAGAAGG - Intergenic
1200498922 Y:3920612-3920634 TTTTAAAGGAAAATGGAAGGAGG - Intergenic
1201457194 Y:14181564-14181586 GAACAAGGGGGAATAGAAGGTGG - Intergenic
1201742407 Y:17337926-17337948 TTTCAAGGGAGGAGAGAAGGTGG + Intergenic