ID: 1146138137

View in Genome Browser
Species Human (GRCh38)
Location 17:30341055-30341077
Sequence GGCTCAGGAAAGCTCCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146138137_1146138144 12 Left 1146138137 17:30341055-30341077 CCTGCTGGGAGCTTTCCTGAGCC No data
Right 1146138144 17:30341090-30341112 CCAAATCTTTAGAAGCAGGGTGG No data
1146138137_1146138141 8 Left 1146138137 17:30341055-30341077 CCTGCTGGGAGCTTTCCTGAGCC No data
Right 1146138141 17:30341086-30341108 TTTGCCAAATCTTTAGAAGCAGG No data
1146138137_1146138142 9 Left 1146138137 17:30341055-30341077 CCTGCTGGGAGCTTTCCTGAGCC No data
Right 1146138142 17:30341087-30341109 TTGCCAAATCTTTAGAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146138137 Original CRISPR GGCTCAGGAAAGCTCCCAGC AGG (reversed) Intergenic
No off target data available for this crispr