ID: 1146138144

View in Genome Browser
Species Human (GRCh38)
Location 17:30341090-30341112
Sequence CCAAATCTTTAGAAGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146138140_1146138144 -9 Left 1146138140 17:30341076-30341098 CCAGCAGGAATTTGCCAAATCTT No data
Right 1146138144 17:30341090-30341112 CCAAATCTTTAGAAGCAGGGTGG No data
1146138134_1146138144 24 Left 1146138134 17:30341043-30341065 CCCCTCTTCTTGCCTGCTGGGAG No data
Right 1146138144 17:30341090-30341112 CCAAATCTTTAGAAGCAGGGTGG No data
1146138139_1146138144 -3 Left 1146138139 17:30341070-30341092 CCTGAGCCAGCAGGAATTTGCCA No data
Right 1146138144 17:30341090-30341112 CCAAATCTTTAGAAGCAGGGTGG No data
1146138135_1146138144 23 Left 1146138135 17:30341044-30341066 CCCTCTTCTTGCCTGCTGGGAGC No data
Right 1146138144 17:30341090-30341112 CCAAATCTTTAGAAGCAGGGTGG No data
1146138137_1146138144 12 Left 1146138137 17:30341055-30341077 CCTGCTGGGAGCTTTCCTGAGCC No data
Right 1146138144 17:30341090-30341112 CCAAATCTTTAGAAGCAGGGTGG No data
1146138133_1146138144 25 Left 1146138133 17:30341042-30341064 CCCCCTCTTCTTGCCTGCTGGGA No data
Right 1146138144 17:30341090-30341112 CCAAATCTTTAGAAGCAGGGTGG No data
1146138136_1146138144 22 Left 1146138136 17:30341045-30341067 CCTCTTCTTGCCTGCTGGGAGCT No data
Right 1146138144 17:30341090-30341112 CCAAATCTTTAGAAGCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146138144 Original CRISPR CCAAATCTTTAGAAGCAGGG TGG Intergenic
No off target data available for this crispr