ID: 1146139958

View in Genome Browser
Species Human (GRCh38)
Location 17:30357257-30357279
Sequence TGCTGCCTTCTCAGGGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146139958_1146139971 20 Left 1146139958 17:30357257-30357279 CCTGTGCCCCTGAGAAGGCAGCA No data
Right 1146139971 17:30357300-30357322 TTATTGAGAAAAAGAGAGCATGG No data
1146139958_1146139972 21 Left 1146139958 17:30357257-30357279 CCTGTGCCCCTGAGAAGGCAGCA No data
Right 1146139972 17:30357301-30357323 TATTGAGAAAAAGAGAGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146139958 Original CRISPR TGCTGCCTTCTCAGGGGCAC AGG (reversed) Intergenic
No off target data available for this crispr