ID: 1146140482

View in Genome Browser
Species Human (GRCh38)
Location 17:30363603-30363625
Sequence CTTTGAGAGGTGAAGGTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146140477_1146140482 -8 Left 1146140477 17:30363588-30363610 CCTGTAATCCCAGCACTTTGAGA 0: 10757
1: 300314
2: 262016
3: 147673
4: 132180
Right 1146140482 17:30363603-30363625 CTTTGAGAGGTGAAGGTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146140482 Original CRISPR CTTTGAGAGGTGAAGGTAAG AGG Intergenic
No off target data available for this crispr