ID: 1146143206

View in Genome Browser
Species Human (GRCh38)
Location 17:30387939-30387961
Sequence GCTCAGAGGAGACCGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 864
Summary {0: 1, 1: 70, 2: 174, 3: 201, 4: 418}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146143206 Original CRISPR GCTCAGAGGAGACCGGCAGT GGG Intronic
900365476 1:2310408-2310430 GCTCAGAGGGGACGGGGACTAGG - Intergenic
900439314 1:2645429-2645451 GCTCAGAAGGGCCCGGCAGTGGG + Exonic
901000606 1:6147049-6147071 GCACACAGGAGATGGGCAGTGGG + Intronic
901403513 1:9031215-9031237 GCTCAGAGGAGGCCCACAGTAGG + Intergenic
901659334 1:10788848-10788870 GCACAGAGGAGCCCACCAGTGGG + Intronic
901936648 1:12631338-12631360 GCTCAGAGGAAACTGGCAGGGGG - Intergenic
903101799 1:21036136-21036158 GCAGAGAGGAGGCCTGCAGTGGG - Intronic
903101820 1:21036277-21036299 GCTCAGAGGAGACCTGCAGTGGG - Intronic
903672087 1:25042468-25042490 GCTCAGAGGAGACCTGCCATGGG + Intergenic
904365694 1:30009808-30009830 GCTCAGAGAAGACCCACAGTGGG + Intergenic
904443832 1:30551475-30551497 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
904732660 1:32606628-32606650 GCTCTCAGGAGACCTGAAGTGGG + Intronic
905520688 1:38597288-38597310 GCTCAGTGGTGGCAGGCAGTGGG + Intergenic
905546150 1:38801901-38801923 GCTCAGAGGAGACCCTCAGTGGG - Intergenic
905798660 1:40829700-40829722 CCTTAGAGGAGACCTGAAGTGGG - Intronic
906082355 1:43101706-43101728 GCTCACAGGACACCTGCAGGGGG + Intergenic
906448203 1:45921984-45922006 GCTTAGAGGGGACCCGCAGTGGG + Intronic
907252971 1:53155319-53155341 GTTCAGAGGAGACCCTCAGCGGG - Intergenic
907603737 1:55794817-55794839 GCTCGGAGGAGACCTGGAATGGG - Intergenic
907761872 1:57368662-57368684 GCTCAGAGGAGACCTGCAGTGGG - Intronic
908259273 1:62327148-62327170 GCTCAGAGGAGACCCACAGTGGG + Intergenic
908739840 1:67316239-67316261 GCTCTGAGGATACTGGCAGGAGG + Intronic
909282360 1:73771177-73771199 GCTCAGAGAAAACCCTCAGTGGG - Intergenic
910602090 1:89043205-89043227 GCTCAGAGGAAACCCACAGTGGG + Intergenic
910654903 1:89609655-89609677 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
911004100 1:93199732-93199754 GCTCAGAGGAGACCCACAGTGGG + Intronic
911025089 1:93427387-93427409 GCTTAGAGGAGGCCCACAGTAGG - Intergenic
911266992 1:95754138-95754160 ACTCAAAGGAGACCAGCAGCGGG - Intergenic
911275616 1:95854175-95854197 GCTCAGAGAACACCCACAGTGGG - Intergenic
912013718 1:105005422-105005444 GCAGAGAGGAGACCCTCAGTGGG + Intergenic
915200253 1:154221457-154221479 GATCAGAGGAGGCCCGCAGTGGG - Intronic
916966095 1:169944737-169944759 GCAGAGAGGAGATCTGCAGTGGG + Intronic
918963167 1:191306414-191306436 GCTCAGAGGAGAGCCGCACTGGG + Intergenic
918983630 1:191595814-191595836 GCTCAGAGGAGACCCGCAGTGGG + Intergenic
919083203 1:192891136-192891158 GCTCAGAGGAGACCCACGGTGGG + Intergenic
919249131 1:195030381-195030403 GCAGAGAGGAAACCTGCAGTGGG + Intergenic
919513390 1:198493863-198493885 GCTCAGAGGAGACCCACAGTGGG + Intergenic
921674649 1:217964790-217964812 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
921766891 1:218983105-218983127 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
922547711 1:226471096-226471118 GCCCAGAGGCGACAGGCAGGTGG + Intergenic
922861361 1:228819083-228819105 GCTCAGAGGAGATCCTCAGTGGG - Intergenic
923328185 1:232898859-232898881 GCAGAGAGGAGACCCACAGTGGG - Intergenic
923391405 1:233516429-233516451 GCTCTGAGGAGACTGGCAGTGGG - Intergenic
923917921 1:238529937-238529959 GCTCTCAGGAGACTGGCAATGGG + Intergenic
924750179 1:246880121-246880143 ACTAAGAGGAAACAGGCAGTTGG + Intronic
1062771387 10:104433-104455 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1064149215 10:12849011-12849033 GCCCAGAGGTGAGCGGCATTGGG - Intergenic
1065201424 10:23316696-23316718 GCTAAGAGAAGACCCACAGTGGG + Intronic
1065407923 10:25389492-25389514 GCTCAGAGGAGATCTGCAGTGGG - Intronic
1066101501 10:32122287-32122309 GCTCAGAGGAGACCCGCAGGGGG + Intergenic
1066188913 10:33037436-33037458 GCTCTCAGGAGACCTACAGTGGG - Intergenic
1067042152 10:42960696-42960718 GCTCAGAGGAGCCTGGGAGGAGG - Intergenic
1067258667 10:44667038-44667060 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
1068060555 10:52063664-52063686 GCTCAGAGAAAACCTGCAGTGGG + Intronic
1068130531 10:52889988-52890010 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1068157645 10:53222434-53222456 GCTCAGAGGGGACCTGCAGTGGG + Intergenic
1068283615 10:54908678-54908700 GCTCAGAGGAGACCCGCAGTGGG + Intronic
1068290972 10:55001197-55001219 GCTCTCAGGAGACCCGAAGTGGG - Intronic
1068474472 10:57507481-57507503 GCTCTTAGGAGACCCGAAGTGGG - Intergenic
1069003985 10:63297401-63297423 GCGGAGAGGAGACCTGAAGTAGG - Intronic
1069561748 10:69435669-69435691 GCAGAGAGGAGACCTGGAGTGGG + Intergenic
1070096183 10:73340283-73340305 GCAGAGAGGAGACCCACAGTGGG + Intronic
1070201141 10:74207507-74207529 GCTCTCAGGAGACCCGAAGTGGG + Intronic
1071060845 10:81570041-81570063 GCTCAGAGGGGACCCACAGTGGG + Intergenic
1071166751 10:82816335-82816357 GCTCTCAGGAGACCCGAAGTGGG + Intronic
1072154680 10:92714277-92714299 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1072335494 10:94394890-94394912 GCTCGGAAGAGACCCACAGTGGG + Intergenic
1072470150 10:95706392-95706414 GCTCAGAGGAGACCCTCAGTGGG + Intergenic
1073260670 10:102188105-102188127 GCTCAGGGGAGACGCACAGTGGG + Intergenic
1074247901 10:111713392-111713414 GCTCAGGGGAGACCCACAGTGGG + Intergenic
1074301784 10:112240146-112240168 GCAGAGAGGAGACCAGGAGTGGG + Intergenic
1074801568 10:117005472-117005494 GTTCAGAGAAAACCGGCTGTGGG + Exonic
1075007884 10:118843499-118843521 GCTCAGAGGAAACCTACAGGGGG - Intergenic
1075132049 10:119748561-119748583 GCTCTCAGGAGACCTGAAGTGGG + Intronic
1076138020 10:128058274-128058296 GCTCAGAGAAGACTTGCAGTGGG - Intronic
1076202515 10:128569683-128569705 GCACAGAGGAGGCAGGCTGTCGG + Intergenic
1076451670 10:130560857-130560879 GCTCAGAGGATAGCGGCTGCTGG + Intergenic
1076536580 10:131181667-131181689 GCCCGGAGGAGACCTGCAGTGGG + Intronic
1077844661 11:6012243-6012265 GCTCAGAGAAGACCTGAAGTGGG + Intergenic
1078042714 11:7883616-7883638 GCTCAGAGGAGACCCACAGAGGG + Intergenic
1078345509 11:10544530-10544552 GCTGAGAGGAGACCCACAGTGGG + Intergenic
1078836364 11:15034637-15034659 GCTCAGAGGAGACCTACAGTGGG + Intronic
1079503911 11:21132957-21132979 GCTCTCAGGAGACCCGAAGTAGG + Intronic
1079710657 11:23679556-23679578 GCTCAGGGAAGACCCGCAGTGGG + Intergenic
1079997034 11:27305507-27305529 GCTCTCAGGAGACTGGAAGTGGG - Intergenic
1080583919 11:33665255-33665277 GCTCAGAGGAGACCCACAGTGGG + Intronic
1080851949 11:36077992-36078014 GCTCAGAGGAGACTCACAGTGGG + Intronic
1080966958 11:37224475-37224497 GCTGAGAGGAGACTTGCAGTGGG + Intergenic
1082687665 11:56260135-56260157 GCTCTAAGGAGACCTGCAGTGGG + Intergenic
1083066729 11:59931748-59931770 GCTCAGTGGAGACCAACAGTAGG + Intergenic
1083312247 11:61790037-61790059 GCTCAGAGCAGCCAGGCAGAGGG + Intronic
1083713522 11:64562857-64562879 GCCCAGGGGACAGCGGCAGTGGG - Intronic
1084396945 11:68917477-68917499 ACTCAGAGGAGACCAGAAATTGG - Intronic
1084469443 11:69348492-69348514 GCTCAGAGGAGACCCGCAGTGGG + Intronic
1084981594 11:72831837-72831859 GCTCAGAGAAGCCCTGCAGCTGG + Intronic
1085212151 11:74791156-74791178 GCTGAGAGGAGATCCACAGTGGG + Intronic
1085334182 11:75678597-75678619 GCTCTCAGGAGACCTGCAGTGGG + Intergenic
1085403979 11:76250835-76250857 GCTCTCAGGAGACCTGAAGTAGG - Intergenic
1085435215 11:76493632-76493654 GCTGAGAGAAGACCCACAGTGGG - Intronic
1086249345 11:84795217-84795239 GCAAAGAGGAGACCCACAGTGGG - Intronic
1086249385 11:84795494-84795516 GCTCAGAGGAGACCTGCAGTGGG - Intronic
1086508257 11:87528381-87528403 GCTCTGAGGAGACCTACAGTGGG + Intergenic
1087037847 11:93772704-93772726 GCTCAAAGAAGACCTGCAGTGGG + Intronic
1087211012 11:95446598-95446620 GCTCAGAGGAGACCCACATTGGG + Intergenic
1087338874 11:96877947-96877969 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1087338883 11:96878017-96878039 GCAGAGAGGAGACCCACAGTGGG + Intergenic
1087407860 11:97752242-97752264 GCCAAGAGGAGACCTGCAGTAGG + Intergenic
1087453402 11:98353245-98353267 GCTGAGAGGAGACCCACAGTGGG + Intergenic
1088135707 11:106553011-106553033 GCTCAGAGGAGACCTGCAGGGGG - Intergenic
1088287922 11:108206839-108206861 GCCCTCAGGAGACCTGCAGTGGG + Intronic
1088513347 11:110600021-110600043 GCTCAGAGGAGACCCACAGGGGG - Intronic
1088651183 11:111959020-111959042 GCTCAGAGGAGACGTGCAGTGGG - Intronic
1088704218 11:112447480-112447502 GCTCAGAGGAGACCCGCAGTGGG + Intergenic
1089185259 11:116610579-116610601 GAGCAGAGGAGAGCGGCAGCTGG + Intergenic
1089759384 11:120711840-120711862 GCCCAGAGGAGACAGGAGGTGGG + Intronic
1089822450 11:121241008-121241030 GCTCAGAAGAGACCCGCAGTGGG + Intergenic
1090124842 11:124075150-124075172 GCTCAGAGGGGACCTGCAGTGGG + Intergenic
1090136970 11:124209313-124209335 GCTCAGAGGAGACCTGCAATGGG + Intergenic
1090795238 11:130129774-130129796 GATCAGAAGAGAACGGGAGTGGG + Intronic
1090910096 11:131111187-131111209 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1090954748 11:131504154-131504176 GCTCAAAGGGGACTGGCAGGGGG - Intronic
1092256556 12:6929046-6929068 GGTCAGAGGTGACCTGCAGTAGG - Intronic
1092271995 12:7030883-7030905 GCTCTCAGGAGACCTGTAGTGGG + Intronic
1092508163 12:9125227-9125249 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1093059542 12:14588850-14588872 GCTCAGAGGAGAGCCGCAGTGGG + Intergenic
1093317179 12:17666433-17666455 GCTCTCAGGAGACTGGAAGTGGG + Intergenic
1094175468 12:27536798-27536820 GCTCAGAAAAGACCCACAGTTGG - Intronic
1094427359 12:30328755-30328777 GCTCGGAGGATACCTGTAGTGGG - Intergenic
1095042373 12:37456367-37456389 GCTCAGAGGAGACCCATGGTGGG - Intergenic
1095603257 12:44038006-44038028 GCTAAGAGGAGACCCTCAGTGGG - Intronic
1095826144 12:46531700-46531722 GCTCAGAGGGGAACCACAGTGGG - Intergenic
1095886524 12:47194150-47194172 CCTGAGAGGAGGCAGGCAGTGGG - Intronic
1096171951 12:49478920-49478942 GCTCAGCGGAGACCCGCAGTGGG + Intronic
1096295610 12:50381388-50381410 GCTCAGAGGAGACCCTCAGTGGG + Intronic
1096295621 12:50381458-50381480 GCAGAGAGGAGACCCACAGTGGG + Intronic
1096355483 12:50937717-50937739 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1096602928 12:52742926-52742948 GCTCAGAAGTGACCCACAGTGGG - Intergenic
1096870039 12:54587548-54587570 GCTCAGAGCAGCCTGGCAGAGGG - Intronic
1096944651 12:55391713-55391735 GCTCAGAGGAGACCAGCAGCAGG + Intergenic
1097076206 12:56396791-56396813 GCTCAGAAGAGACCCACAGTGGG + Intergenic
1097078126 12:56410263-56410285 GTTCAGAGGAGACCCACAGTGGG + Intergenic
1097129905 12:56804360-56804382 GCTCAGAGGAAACCTGCAGGGGG + Intergenic
1097360756 12:58655941-58655963 GCTCTCAGGAGACCTGAAGTGGG + Intronic
1097446451 12:59678373-59678395 GCTCAGAGGAGACCTGCAGTAGG + Intronic
1097500298 12:60392810-60392832 GCTCAGAGAAGACCCACATTAGG - Intergenic
1098671398 12:73235121-73235143 GCACAGAGGAGACCCGTGGTGGG + Intergenic
1098802949 12:74985249-74985271 GCTCAGAGGAGACTTGAAGTGGG + Intergenic
1098951642 12:76645666-76645688 GCTCGGAGGAGACCCAAAGTGGG - Intergenic
1099049724 12:77768002-77768024 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1099295451 12:80823068-80823090 GCTCAGAAGAGACCCACAGTGGG - Intronic
1100672764 12:96834909-96834931 GCTCACAGGAGACCTGCAGCAGG + Intronic
1101086306 12:101239786-101239808 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1101580858 12:106039977-106039999 GCAGAGAGAAGACCTGCAGTAGG + Intergenic
1101763938 12:107681872-107681894 GCTCAGAGAAGACCCACAGTGGG + Intergenic
1102144141 12:110641803-110641825 GCTGGGGGGAGACTGGCAGTTGG + Intronic
1102449480 12:113030064-113030086 GCTCAGGGGAGACCAGCAAGTGG - Intergenic
1102498791 12:113337222-113337244 GCTCAGAGGTCACCGCCACTAGG + Intronic
1103355577 12:120317353-120317375 GCCCACAGGAAACCGGCAGGAGG + Intergenic
1104950479 12:132437655-132437677 GCTCAGTGGTGAACGGCAGACGG + Intergenic
1105041924 12:132967455-132967477 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1105805110 13:23947946-23947968 GCTCAGAAGTGTCTGGCAGTGGG - Intergenic
1106253472 13:28001615-28001637 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1106308980 13:28535994-28536016 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1106379595 13:29223544-29223566 TCTCAGAGGAGACTTGCAGTGGG - Intronic
1106979082 13:35256142-35256164 GCAGAGAGGAGACCTGCAATGGG + Intronic
1108016968 13:46086380-46086402 GCTCAGAGGAGACTCGCGGTGGG + Intronic
1108542532 13:51456983-51457005 GCAGAGAGGAGACCCACAGTGGG - Intergenic
1108559385 13:51627847-51627869 GCAGAGAGGAGACCCACAGTGGG + Intronic
1108573171 13:51769699-51769721 GCTCAGAGGATCCTGGCTGTTGG + Intronic
1108616832 13:52141482-52141504 ACTCAGAAGAGACCAGCAGGAGG + Intronic
1108787410 13:53921497-53921519 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1109396453 13:61765976-61765998 GCTCAGAGGAGACCTGCATTGGG + Intergenic
1109420525 13:62105806-62105828 GAAGAGAGGAGACCTGCAGTGGG - Intergenic
1109438944 13:62343789-62343811 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1109470694 13:62799888-62799910 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1109633658 13:65085566-65085588 GCTCAGAGAGGACCTGGAGTGGG + Intergenic
1109686695 13:65830124-65830146 GCTCTCAGGAGACCCGCAGTGGG - Intergenic
1109687835 13:65844165-65844187 GTTCTCAGGAGACCTGCAGTGGG - Intergenic
1109780802 13:67107530-67107552 GGAGAGAGGAGACCTGCAGTGGG - Intronic
1109837486 13:67878026-67878048 GCAGAGAGGAGACCCACAGTGGG - Intergenic
1109837497 13:67878097-67878119 GCTCAGAGAAGACCTGCAGTGGG - Intergenic
1109851795 13:68075423-68075445 GCAGAGAGAAGACCGGAAGTGGG - Intergenic
1110201182 13:72851843-72851865 GCTGAGAGGAGACCCACAGTTGG - Intronic
1110201188 13:72851913-72851935 GCTGAGAGGAGACCCACAGTGGG - Intronic
1110778024 13:79432686-79432708 GCTCAGAGGAGACCTTCAGTGGG - Intergenic
1110939495 13:81331105-81331127 GTTCAGAGGAGACCTGTAGTGGG - Intergenic
1111202785 13:84961722-84961744 GCTCTCAGGAGACCCGTAGTGGG + Intergenic
1111237818 13:85431565-85431587 ACTCAGTGGAGACCCACAGTGGG - Intergenic
1111243775 13:85508604-85508626 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1111337191 13:86839751-86839773 GCTTAGAGAAGACCAGCAGTGGG + Intergenic
1111485726 13:88896072-88896094 GCTGAGAGGAGACCCATAGTGGG - Intergenic
1111512619 13:89286944-89286966 GCTGAGAGGTGACCTGCAGTTGG + Intergenic
1111595433 13:90404474-90404496 GCTCTCAGGAGACCCGAAGTGGG - Intergenic
1111800421 13:92974459-92974481 GCTCAGAGGAGACCCACAGTAGG + Intergenic
1112740861 13:102471863-102471885 GCTCAGAGGAGAACTTCAGGGGG + Intergenic
1112748338 13:102553065-102553087 GCAGAGAGAAGACGGGCAGTGGG - Intergenic
1113339214 13:109405199-109405221 GCTCAGAGGAGACTTGCAGTGGG - Intergenic
1113503124 13:110793854-110793876 GCTCTTAGGAGACCTGGAGTGGG - Intergenic
1113970744 13:114186342-114186364 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1114187124 14:20411210-20411232 GCTGGGAGGTGACCGGAAGTCGG - Intronic
1114349524 14:21835278-21835300 GCTCAGAGGAGACCTGCATTGGG + Intergenic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1114624281 14:24118586-24118608 GCTCAGAGGGGACAGGCACATGG - Intronic
1114980476 14:28157960-28157982 GTTCTGAGGAGACCTGCAGTGGG + Intergenic
1115059140 14:29169012-29169034 GTAGAGAGGAGACCTGCAGTGGG - Intergenic
1116083361 14:40204326-40204348 GCTGACAGGAGACCTGCAGTGGG + Intergenic
1116131457 14:40859651-40859673 GCTCAGAGGATATCCACAGTGGG - Intergenic
1116159715 14:41253370-41253392 GCTCTCAGGAGACCGGAAGTGGG + Intergenic
1116221645 14:42095756-42095778 GCTCAGAGGAGACCTGCAATGGG + Intergenic
1116257275 14:42571777-42571799 CCTCAGAGGAGACCCAGAGTGGG - Intergenic
1116961696 14:50973723-50973745 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1117149716 14:52873136-52873158 GTTCCGAGGAGAAAGGCAGTAGG + Intronic
1117285443 14:54282334-54282356 GCTCAGAGGAGACCCGCAGTGGG + Intergenic
1117734061 14:58751557-58751579 GCTCAGAGGAGACCTGCATTGGG - Intergenic
1117930914 14:60839390-60839412 GCTCTGAGGAGACTGGAAGGGGG - Intronic
1118213491 14:63787576-63787598 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1118410042 14:65469608-65469630 GCTCAGAGGAGAGCTGCAGAGGG + Intronic
1118473068 14:66093372-66093394 GCTCACAGGAGACCCGCAGTGGG + Intergenic
1118521966 14:66595972-66595994 GCTTAAAGGAGACCCACAGTGGG + Intronic
1118521986 14:66596112-66596134 GCAGAGAGGAGACCCTCAGTGGG + Intronic
1118946968 14:70397915-70397937 GCTCAGAGGGGACCTGCAGGGGG + Intronic
1120405780 14:84091735-84091757 GCTCAGACGAGACCCACAGTGGG - Intergenic
1120590083 14:86364439-86364461 GCTCAGAGGAGACCTACATTGGG - Intergenic
1120592352 14:86390853-86390875 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1120841457 14:89089070-89089092 GGGCAGAGGAGACTGGCAGGAGG + Intergenic
1121137107 14:91509590-91509612 GCTCAACGAGGACCGGCAGTGGG - Exonic
1121695295 14:95907632-95907654 GCTCAGAGGAGATCTGCAATGGG + Intergenic
1202840237 14_GL000009v2_random:114595-114617 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1202909618 14_GL000194v1_random:104792-104814 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1202883668 14_KI270722v1_random:84510-84532 GCTCAGAGGGGACCTGCAGTGGG + Intergenic
1202940900 14_KI270725v1_random:144092-144114 GCTCAGAGGAGACCCATAGTGGG - Intergenic
1123888406 15:24749668-24749690 GCTCAGAGAAGCCCTACAGTGGG - Intergenic
1124340783 15:28887913-28887935 GAGCCCAGGAGACCGGCAGTAGG - Intronic
1124820916 15:33044801-33044823 GCTCAGAGGAGACCTACAGTGGG - Intronic
1125241596 15:37582652-37582674 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1125718209 15:41831724-41831746 GCTCAGAGGAGACCCACAGTGGG - Intronic
1125752417 15:42037468-42037490 GCTCAGAGGAGACCCGCAGTAGG - Intronic
1126215251 15:46146665-46146687 GCTCAAGGGAGACCTACAGTGGG - Intergenic
1126292563 15:47099151-47099173 GCTCCGAGGAGACCCATAGTGGG + Intergenic
1127525860 15:59791689-59791711 GCTCAGAGGAGACCCGCAGTGGG + Intergenic
1128222431 15:65978773-65978795 CCTCAGAGGAGACAGACAGATGG + Intronic
1128965342 15:72052335-72052357 GCTCAGAGGAGACTCGCAGTGGG - Intronic
1129225905 15:74170350-74170372 TCTGAGAGGAGAGAGGCAGTCGG - Intergenic
1129368990 15:75076268-75076290 GCTCAAAGGAGACCCACAGTGGG + Intronic
1129377693 15:75144592-75144614 GCTTAGAGGAGACCTGAAATAGG + Intergenic
1129785155 15:78304856-78304878 GCTCAGAGAAGACCCGCAGTGGG - Intergenic
1130227773 15:82072937-82072959 GCTCAAAGAAGACTTGCAGTGGG + Intergenic
1130261052 15:82354862-82354884 GCGGAGAGGAGACCGTGAGTGGG + Intergenic
1130280183 15:82514156-82514178 GCGGAGAGGAGACCGTGAGTGGG - Intergenic
1130471558 15:84230342-84230364 GCGGAGAGGAGACCGTGAGTGGG - Intergenic
1130479052 15:84344913-84344935 GCGGAGAGGAGACCGTGAGTGGG - Intergenic
1130492718 15:84443218-84443240 GCGGAGAGGAGACCGTGAGTGGG + Intergenic
1130593852 15:85234969-85234991 GCGGAGAGGAGACCGTGAGTGGG - Intergenic
1130856073 15:87841158-87841180 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1131022147 15:89107880-89107902 GCTCAGAGGACACAGACAGCTGG - Intronic
1131035859 15:89221688-89221710 GCTCACAGGAGGCCCTCAGTGGG + Exonic
1131999196 15:98162682-98162704 GCTCTCAGGAGACCTGGAGTGGG + Intergenic
1132738571 16:1399333-1399355 GCTCAGAGGACTCCGGCTGGTGG - Intronic
1135650176 16:24199179-24199201 TCTCAGAGGATACGGGCAATGGG - Intronic
1135986836 16:27190115-27190137 GCTCTCAGGAGACCAGAAGTGGG - Intergenic
1135993375 16:27230804-27230826 GCTCAGAGGCGCCCTGCAGAAGG + Intronic
1136296915 16:29309062-29309084 GGACAGAGGAGACGGGCAGAGGG - Intergenic
1137256464 16:46778893-46778915 GCTCAGAGGAGACCTGCAGGGGG - Intronic
1137334266 16:47532950-47532972 ACTTAGAGGAGACCTGCAGTGGG + Intronic
1137343940 16:47637116-47637138 GCTGAGAGGAGACCCGCAGTGGG - Intronic
1137588658 16:49680018-49680040 GCTCAGAGGAGACCCACAGTGGG - Intronic
1137588685 16:49680211-49680233 GCTGAGAGGACACCTGCAGTGGG - Intronic
1137623339 16:49891568-49891590 GCTCAGAGGAGACTGGCAGTGGG + Intergenic
1137825225 16:51489220-51489242 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1138033480 16:53579765-53579787 GCCCAGAGGAGACCTGCAGTGGG + Intergenic
1138925065 16:61581115-61581137 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1138998261 16:62478394-62478416 GCTCTCAGGAGACCTGAAGTTGG - Intergenic
1139183159 16:64770953-64770975 GTTCAGAGGAGGCCTGCATTGGG - Intergenic
1139389968 16:66601317-66601339 GCTCAGAGGAGACTGACAGTGGG + Intergenic
1139625775 16:68187512-68187534 GCTCAGAGAAGACCCACAGAGGG + Intronic
1140419506 16:74807067-74807089 GCTCAGAAGAGACCGGAAGTGGG + Intergenic
1141606116 16:85154295-85154317 TCTCAGAGGAGACCCCAAGTGGG + Intergenic
1141704203 16:85655737-85655759 CCTCAGGGCAGACAGGCAGTAGG - Exonic
1142221612 16:88857544-88857566 GCTCCGGGGAGACTGGCAGGAGG - Intronic
1142388828 16:89784748-89784770 GCTCAGAGCAGATCTGCAGGAGG + Intronic
1143993199 17:10984634-10984656 AGTCAGAGGGGACCTGCAGTTGG + Intergenic
1144390014 17:14784645-14784667 GCTTTCAGGAGACCCGCAGTGGG - Intergenic
1144695535 17:17301622-17301644 CTTCAGAAGAGACCTGCAGTGGG - Intergenic
1145868797 17:28257127-28257149 CCTAAGAGGAGGCCGGCAGAGGG + Intergenic
1146086976 17:29838745-29838767 GCTCAGAGGAGACCCACAGTGGG - Intronic
1146093547 17:29906041-29906063 GCTCAGAGGAGACCCGCAGTGGG - Intronic
1146143206 17:30387939-30387961 GCTCAGAGGAGACCGGCAGTGGG + Intronic
1146425351 17:32732599-32732621 GCTCAGAGGAGAATCTCAGTGGG - Intronic
1148128048 17:45246937-45246959 GGTCGGAGGTGACCTGCAGTGGG - Exonic
1149085546 17:52710753-52710775 GCTCAGAGGAAACCCACAGTGGG - Intergenic
1149169490 17:53792433-53792455 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1149238021 17:54616179-54616201 GCTTAGAGGAGACCCACGGTGGG - Intergenic
1149329907 17:55570104-55570126 GCTCAGAGAAGACCCACACTGGG - Intergenic
1149482871 17:57017743-57017765 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1149853261 17:60054416-60054438 GCTCAGTGGAGACCGTGTGTAGG - Intronic
1149884721 17:60328452-60328474 GCTTAGAGGAGACCTGCAGTGGG - Intronic
1150521096 17:65866819-65866841 GCTCAGAGGAGACCCAGAGTGGG - Intronic
1150952862 17:69822173-69822195 GCTCAGTGGAGACCTGCAGTGGG - Intergenic
1151009997 17:70483579-70483601 GCCCAGAGGAGACCTGTAGTGGG + Intergenic
1151395245 17:73819040-73819062 GCTCAGAGGAGACCCGCAGTGGG + Intergenic
1151773147 17:76177973-76177995 GCTCAGAGGATACCCGCAGTGGG - Intronic
1151933442 17:77247364-77247386 CCTCAGAGGGCAACGGCAGTGGG - Intergenic
1152530515 17:80915976-80915998 GCTCAGAGGAGACCCACAGTTGG - Intronic
1152807232 17:82361940-82361962 GCTCAGTGGGGACCTGCAGAGGG - Exonic
1152856570 17:82668091-82668113 GCTCAGGGGAGACCCACAGTGGG + Intronic
1152864162 17:82712374-82712396 GCTCAGAGGAGACTCGCAGTGGG + Intergenic
1153139307 18:1954179-1954201 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1155027860 18:21958501-21958523 ACTCACAGCAGACCCGCAGTGGG + Intergenic
1155120631 18:22815963-22815985 GCTCAGAGGAGACCTGCAGTGGG + Intronic
1156160409 18:34351535-34351557 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1156298732 18:35817437-35817459 ACTCAGAGGAGACCCGCAGTGGG + Intergenic
1157006382 18:43589425-43589447 GCTCAGAGGAGAGCCACAGTGGG + Intergenic
1157042847 18:44060837-44060859 GCTCAGAGAAGACCCACAGTAGG + Intergenic
1157252165 18:46104503-46104525 GCGCACAGGAGACCCGCTGTCGG - Intronic
1157506704 18:48231463-48231485 GCAGAGAGGAGACCCACAGTGGG - Intronic
1158023336 18:52869267-52869289 GCTCAGAGGAGACCCACAGTAGG + Intronic
1158139401 18:54241395-54241417 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1158198015 18:54910087-54910109 GCTCAGAGGAAACCTGCAGGGGG + Intronic
1158349312 18:56549058-56549080 GGGACGAGGAGACCGGCAGTGGG + Intergenic
1158633045 18:59132661-59132683 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1159189025 18:65017586-65017608 GCTCAGAGGAGACTCGCAATGGG + Intergenic
1159623896 18:70669841-70669863 GCTCAGAGGAGAACTGAATTGGG - Intergenic
1160116591 18:76084800-76084822 GCAGAGAGGAGACCGGCAGTGGG + Intergenic
1160986225 19:1840185-1840207 GCTCAGAAGAGCCTGGCAGGGGG - Intronic
1161080610 19:2308213-2308235 GCGCCGAGGAGACCGGCGGGCGG - Intronic
1161272348 19:3397083-3397105 GCTCAGATGAGCCAGGCACTTGG - Intronic
1161586165 19:5106996-5107018 CCTCAGTGGAGACTGGCAGTGGG + Intronic
1162020336 19:7865318-7865340 GAGCAGAGGAGACAGGCACTGGG + Intergenic
1162231658 19:9271364-9271386 GCTTAGAGGAGACCCACAGTGGG - Intergenic
1164984471 19:32638359-32638381 GCTCTCAGGAGACCCACAGTGGG - Intronic
1165022700 19:32936931-32936953 GTTCAGAGGAGACCCACAGTGGG - Intronic
1166898188 19:46037039-46037061 GCTCAGAAGAGACCCACAGTGGG - Intergenic
1167013223 19:46822400-46822422 GCTCAGAGGAGACCGTCAGTGGG - Intergenic
1167235115 19:48309513-48309535 GCTCAGAGGAGACCTGCAGGGGG - Intronic
1167346290 19:48947449-48947471 GCTCAGGGGAGACCCGCAGTGGG - Intergenic
1202632820 1_KI270706v1_random:15962-15984 GCTCAGAGGAGACGTGCAGTGGG + Intergenic
1202653058 1_KI270707v1_random:24087-24109 GCTCAGAGGAGAACTGCAGTGGG - Intergenic
1202659093 1_KI270708v1_random:51658-51680 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
924963932 2:58315-58337 GCTCAGAGGAGACCCACAGGTGG - Intergenic
925067973 2:943888-943910 GCTCAGAGGACACCCGCAGGGGG + Intergenic
925289023 2:2734271-2734293 GCTTTGAAGAGACAGGCAGTGGG + Intergenic
925718049 2:6803024-6803046 GGTCAGGGGAGACTGGCACTGGG + Intergenic
926027396 2:9556433-9556455 CCTCAGACGACTCCGGCAGTAGG - Intergenic
926554595 2:14342076-14342098 GCTCAGAGGAGACCCGCAATGGG - Intergenic
926953626 2:18271302-18271324 GCTCAGAGGAGAAACGCAGTGGG + Intronic
926958781 2:18331920-18331942 ACTCAGAGAAGACCAGCAGTGGG + Intronic
927206318 2:20613335-20613357 GCTCTGAGGATGCTGGCAGTGGG - Intronic
927613524 2:24566193-24566215 CCTCAGAGGAGACTTGCAATAGG + Intronic
928723548 2:34147165-34147187 GCTCAGAGGAGTCCTGCAGTGGG + Intergenic
928823464 2:35391406-35391428 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
929014619 2:37481971-37481993 GCTCAGAGCAGACCTCCATTGGG - Intergenic
929175497 2:38971404-38971426 GCTCAGATGTGCCCTGCAGTCGG + Intronic
929847093 2:45541622-45541644 GCAGAGAGGAGACCCACAGTGGG + Intronic
930612073 2:53554603-53554625 GCTCAGAGGAAACCTGCAGTAGG - Intronic
930729058 2:54709921-54709943 GCTCAGAGGAGACCCGCAGTAGG - Intergenic
930800607 2:55438810-55438832 GCTCAGAGGAGACCTGTAGTGGG - Intergenic
930957315 2:57217934-57217956 ACTCAGAGGAGACCTACATTGGG - Intergenic
930971147 2:57397362-57397384 GCTCCGAGGAGACCTGCAGTGGG + Intergenic
931300546 2:60974165-60974187 GTTCAGAGAAGACCCACAGTGGG - Intronic
931500131 2:62856038-62856060 GCTCAGAGGAGACTCGCAGTGGG - Intronic
931622984 2:64229749-64229771 GCTGAGAGGGGAGCGCCAGTGGG + Intergenic
931668029 2:64624195-64624217 GGTGAGAGGTGACTGGCAGTGGG + Intergenic
932054670 2:68432294-68432316 GCTCAGAGGAGAACCACAGTAGG + Intergenic
932173305 2:69577133-69577155 GCTCAGAGTGAACCTGCAGTTGG - Intronic
932501596 2:72187478-72187500 GCTCAGAGATGACCCACAGTGGG + Intronic
933063674 2:77768699-77768721 GCTTACAGGAGGCCCGCAGTGGG - Intergenic
933093352 2:78147135-78147157 GCTCAGAAGACACCCGCAGTGGG - Intergenic
933113104 2:78429634-78429656 GCTCAGAGGAGACTCACAGTGGG - Intergenic
933383773 2:81583984-81584006 GATCAGAGGAGACCCGCAGTGGG - Intergenic
933624647 2:84585457-84585479 GCTCGGAGGAAATCCGCAGTGGG + Intronic
937163981 2:119794893-119794915 GCTCAGAGGAGACCTGCAGTGGG + Intronic
937737884 2:125313597-125313619 GCTCTCAGGAGACCCACAGTGGG - Intergenic
938180607 2:129178947-129178969 GCTCAGAGGAAACCCTCAGGGGG + Intergenic
938722413 2:134078323-134078345 GCTCAGAGGAGACATTCCGTGGG + Intergenic
938732526 2:134157956-134157978 GCTGAGGGGAGACCCACAGTGGG + Intronic
939084917 2:137707826-137707848 GCAGAGAGGAGACCTGAAGTGGG + Intergenic
940694212 2:156959030-156959052 GCTCAGAAGAGACCCACAGTGGG + Intergenic
941043664 2:160649400-160649422 GCTCAGAGGAGACCCGCAATGGG - Intergenic
941131106 2:161651295-161651317 GCTTTCAGGAGACCAGCAGTGGG - Intronic
942053431 2:172162096-172162118 GCTCAGAGGAGACTCGCAGTGGG + Intergenic
943064147 2:183069466-183069488 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
943179400 2:184524389-184524411 GCAGAGAGGAGACCTGAAGTGGG + Intergenic
943191046 2:184680245-184680267 GCAGAGAGGAGACCCGCAGTGGG - Intronic
943191058 2:184680315-184680337 GCAGAGAGGAGACCCACAGTGGG - Intronic
943363422 2:186947225-186947247 GCTTAGAGGAGACCAGGAGAGGG + Intergenic
943426954 2:187749630-187749652 GCTCAGAGGAGACTCACAGTGGG + Intergenic
943526325 2:189021215-189021237 GCTCAGATGAGACCCACGGTGGG - Intergenic
943734540 2:191339933-191339955 TCTCACAGGAGACCTGCAGGTGG - Intronic
943965616 2:194328280-194328302 GCTCATAGGAGACTTGCAGTGGG - Intergenic
944383829 2:199141902-199141924 GCTCAAAGGAGACCCACGGTGGG - Intergenic
944483877 2:200182834-200182856 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
944586722 2:201179303-201179325 GCTCAGAGGAGGCCCACAGTGGG - Intergenic
946197373 2:218043098-218043120 GCTCGGAGGAGACCTGCAGTAGG + Intronic
947278010 2:228416816-228416838 GCAGAGAGGAGACCAGAAGTAGG + Intergenic
947316731 2:228866775-228866797 GCTCAGAGGAGACCTGCACTGGG - Intronic
947854070 2:233311503-233311525 GCTCAGAGGAGGCCGGCTCCAGG - Intronic
948293550 2:236845003-236845025 GCTCAGAGGAGACCCACAGTAGG + Intergenic
948295520 2:236857397-236857419 GCTGAAAGGAGCCCGGCAGGAGG - Intergenic
948334890 2:237200212-237200234 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
948575347 2:238946369-238946391 GCTCAGAGGAGACCCACAGTGGG + Intergenic
948713046 2:239837090-239837112 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
948800415 2:240430847-240430869 GCTCAGAGGATGCCTCCAGTTGG + Intergenic
1168983379 20:2026701-2026723 GCAGACAGGAGACCTGCAGTGGG + Intergenic
1170043802 20:12065121-12065143 GCTCAGAGGAAACCCACAGGGGG + Intergenic
1170458415 20:16554469-16554491 GCTCAAAGGAGACCCGCACTGGG - Intronic
1171436978 20:25131464-25131486 ACTCAGAGGCCACAGGCAGTTGG + Intergenic
1171536805 20:25899440-25899462 GCTCAGAGGAGATCCATAGTGGG - Intergenic
1171804305 20:29661717-29661739 CCTCAGAGGAGACCCATAGTGGG + Intergenic
1171839747 20:30194705-30194727 GCTCAGAGGAGACCCATAGTGGG - Intergenic
1172115197 20:32569564-32569586 GCTCAGAGGAGCCAGACACTAGG + Intronic
1173207555 20:41006789-41006811 GCTCAGAGGAGACTCACAGTGGG + Intergenic
1173718604 20:45233270-45233292 GCTCAGAGGAGACCTGTAGTGGG - Intergenic
1174068086 20:47879918-47879940 GCACACATGAGACGGGCAGTGGG - Intergenic
1175064417 20:56272898-56272920 GCTCAGGGGAGACCTGCAGTGGG - Intergenic
1175065146 20:56277791-56277813 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1175138598 20:56843044-56843066 GCGGAGAGGAGACCCACAGTGGG - Intergenic
1175553331 20:59831038-59831060 GCACAGAGGAGACAGGGAGCAGG - Intronic
1175683456 20:61008689-61008711 GCTGAGAGGAGACCAGCACTGGG - Intergenic
1175959878 20:62630644-62630666 GCTCAGAGGAGACCCGCCGTGGG + Intergenic
1176104631 20:63380185-63380207 GCTCAGAGGCGACCCGCAGTGGG - Intergenic
1176109450 20:63404794-63404816 GAACAGAGCAGACAGGCAGTGGG + Intergenic
1176582259 21:8542849-8542871 GCTCAGAGGAGACCCATAGTGGG + Intergenic
1176599095 21:8775564-8775586 GCTCAGAGGAGAACTGCAGTGGG + Intergenic
1176628968 21:9119500-9119522 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1176645034 21:9341842-9341864 GCTCAGAGGAGACGTGCAGTGGG + Intergenic
1176973219 21:15289847-15289869 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1176976559 21:15327577-15327599 GCTCAGAGGAGACCTGCAATGGG - Intergenic
1176993074 21:15521867-15521889 GTTCAGAGGAGACCTGTAGTTGG + Intergenic
1177262644 21:18750330-18750352 GCTCAGAGGAGACCCACAGTAGG - Intergenic
1177357780 21:20031385-20031407 CCTCAGAGGAGACCCACAGTGGG + Intergenic
1177396038 21:20537753-20537775 GCTCAGAGGAGACTTGCAGTGGG + Intergenic
1177624835 21:23646391-23646413 GCTGAGAGGAGACCCACAGTGGG + Intergenic
1178244447 21:30937065-30937087 GCTCAGAAGAGACCTGCAGTGGG - Intergenic
1178947416 21:36959729-36959751 GCTCTCAGGAGACCTGAAGTGGG - Intronic
1180178869 21:46108955-46108977 GCTCACAGGAGACCCGCAGGGGG + Intronic
1180265094 22:10519897-10519919 GCTCAGAGGAGACCCATAGTGGG + Intergenic
1180367917 22:11957392-11957414 GCTCAGAGGAGACGTGCAGTGGG - Intergenic
1180378171 22:12113944-12113966 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1180419335 22:12799337-12799359 GCTCAGAGGAGAACTGCAGTGGG - Intergenic
1183024922 22:35057891-35057913 GCTCAGAGGAGACTTGCAGTGGG + Intergenic
1183631615 22:39036467-39036489 CCTCCGAGGAGACAGGGAGTGGG + Intergenic
1183636153 22:39064065-39064087 CCTCCGAGGAGACAGGGAGTGGG + Intronic
1183637444 22:39072960-39072982 CCTCCGAGGAGACAGGGAGTGGG + Intronic
1183975268 22:41508421-41508443 GGTCAGAGGAGAGCGGGAGTGGG - Intronic
1184173924 22:42775302-42775324 GCTCAGAGGAGACCCGCAGTGGG - Intergenic
1184339305 22:43877278-43877300 GCTCACAGGAGGCCCCCAGTGGG + Intergenic
1184514557 22:44954025-44954047 GCTCAGAGCAGACCCCCAGTGGG + Intronic
1184562431 22:45270924-45270946 GCTCAGAGCAGTCAGGTAGTAGG - Intergenic
1184665743 22:45988036-45988058 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1184865786 22:47201298-47201320 GCTCAGAGAAGACCCACAGGGGG + Intergenic
1184950893 22:47842000-47842022 GCTCAGAGGAGCCTGACAGCAGG + Intergenic
1185070319 22:48652466-48652488 GCTCACAGGAGACCGCCTGCTGG + Intronic
949226394 3:1700229-1700251 GCAGAGAGGAGACCCGCAATGGG - Intergenic
949226414 3:1700369-1700391 GCTCTCAGGAGACCTGCAGTGGG - Intergenic
949715745 3:6929308-6929330 GCTAAGAGGGGAGAGGCAGTTGG - Intronic
950207652 3:11092905-11092927 ACTCAGAGGAGACCTGCAGTGGG - Intergenic
950481766 3:13248457-13248479 TCTCAGGGGAGACTGGGAGTAGG - Intergenic
951182236 3:19672050-19672072 GCTCAGAGGAGACCAGCAGTGGG + Intergenic
951264665 3:20552169-20552191 GATCAGAGGAGACCTGCAGTGGG + Intergenic
951326789 3:21312591-21312613 GCTCAGAAGAGACAAGCTGTAGG + Intergenic
951562377 3:23981764-23981786 GCTCAGAGGGGACCTGCAGTGGG + Intergenic
951718422 3:25673531-25673553 ACTCAGAAGAGACTTGCAGTGGG + Intergenic
952016195 3:28959579-28959601 GCTCAGAGGAGACCCAAGGTGGG - Intergenic
952269313 3:31816759-31816781 GCTCAGAGGAGACCCGTAGCGGG + Intronic
952793383 3:37217921-37217943 GCTCAGAGGAGACCGGCATTGGG - Intergenic
953623186 3:44550007-44550029 CCTCAGAGAAGACAGGCAGGGGG + Intergenic
954099311 3:48357347-48357369 GCTCAGAGGAGACCCACAGTGGG + Intergenic
954435008 3:50491307-50491329 GCTCGGAGGAGGACGGCAGGAGG + Intronic
954498081 3:50983631-50983653 GCTCAGAGGAGACTCACAGTGGG - Intronic
954737066 3:52715364-52715386 GCTCAGAGGAGATCCGCAGGGGG - Intronic
957095295 3:75772203-75772225 GCTCAGAGGAGACCTGCAGGGGG - Intronic
957156531 3:76551360-76551382 GCTCTCAGGAGACCTGAAGTGGG - Intronic
957417936 3:79929869-79929891 GCTCTCAGGAGACCCACAGTGGG - Intergenic
957427075 3:80052062-80052084 GCTCAGAGGAGACTTACAGTGGG - Intergenic
957459359 3:80497146-80497168 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
957486738 3:80871262-80871284 GCAGAGAGGAGACCCGCAGTGGG - Intergenic
957636389 3:82790985-82791007 GCTCAGAGGAGGCCCACAATGGG - Intergenic
957665282 3:83218285-83218307 GCTATCAGGAGACCTGCAGTGGG + Intergenic
957705198 3:83770823-83770845 GCTTAGAGGAGACCCACAGTGGG - Intergenic
958141774 3:89571245-89571267 GCAGAGAGGAGACCCGGAGTGGG + Intergenic
958195376 3:90236145-90236167 GCTCAGAGGAGACCCTCAGTGGG - Intergenic
958418795 3:93907560-93907582 GCTCAGAGGAGACCCTCAGTGGG - Intronic
958572892 3:95911268-95911290 GCTCAGAGGAGACCCACAGTGGG + Intergenic
958675510 3:97264760-97264782 GCTCTGAGGAGACCCACAGTGGG + Intronic
959037507 3:101384081-101384103 GCTGAGAGGGGACCCACAGTGGG - Intronic
959252563 3:103966390-103966412 GCTGAAAGGAGACCAGGAGTGGG - Intergenic
959484326 3:106909265-106909287 GTTCAGAGGAGACCTGCAGAGGG - Intergenic
959863617 3:111242561-111242583 GCTCACAGGAGACCTGCAGGAGG + Intronic
959897139 3:111617635-111617657 GCTCTCAGGAGACCTGAAGTGGG - Intronic
960333907 3:116392995-116393017 GCTCAGAGGAGACCCCCAGTGGG - Intronic
960434919 3:117614469-117614491 GCTGACAGGAGAGTGGCAGTGGG - Intergenic
960634194 3:119767816-119767838 GCTCAGAGGAGACCCACAGTGGG + Intergenic
961114279 3:124315373-124315395 GCTCAGAGGAGCCTTGCAGAAGG - Intronic
961311435 3:126004382-126004404 GCTCTCAGGAGACCCGGAGTGGG - Intergenic
961525849 3:127496863-127496885 GCTCAGAGGAGACCAGCAGTTGG - Intergenic
961603907 3:128079580-128079602 CCTCAGAGGACACTGGCAGCCGG + Intronic
961942925 3:130656344-130656366 GCTCAGAGGAGACCTGCAGTGGG + Intronic
962211966 3:133486901-133486923 GCTCAGAGGAGACCCACAGTGGG + Intergenic
962211975 3:133486971-133486993 GCAGAGAGGAGACCCACAGTGGG + Intergenic
962900234 3:139755487-139755509 GCTCAGAGGAGGCAGGCAGTAGG + Intergenic
963805205 3:149715042-149715064 GCTCAGAGGAGACCTGCAGTGGG - Intronic
964075137 3:152684197-152684219 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
964590654 3:158359894-158359916 GCTCAGAGGGGACTGGCAGAGGG + Intronic
964791754 3:160459884-160459906 GCTCAGAGGATCCCCGCAGTGGG + Intronic
964927805 3:161978778-161978800 GCAGAGAGGAGACCCGGAGTGGG + Intergenic
965005684 3:163019513-163019535 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
965118566 3:164521781-164521803 GATCAGAGGAGACCCACAGTGGG + Intergenic
965118587 3:164521918-164521940 GCTGAGAGGAGACCCACAGTGGG + Intergenic
965289970 3:166865818-166865840 TCTCAGAGGAGGCCTGCAGTGGG - Intergenic
965309851 3:167115281-167115303 GCTCAGAGGAAACCTGCAGGGGG + Intergenic
965367803 3:167820999-167821021 GCAGAGAGGAGACCCACAGTGGG - Intronic
965541478 3:169875636-169875658 GCTCAGAGGAGACCCACAGTGGG - Intergenic
965793039 3:172410582-172410604 GCTCAAAGGAGTCCTGCAGTGGG + Intergenic
965984608 3:174736398-174736420 GCTCAGAGAAGACCCACATTGGG + Intronic
966491545 3:180532524-180532546 ACTCATAGGAGACCTGCAGTGGG - Intergenic
967916753 3:194584051-194584073 GCTCCGAGGAGGTAGGCAGTGGG + Intergenic
1202741857 3_GL000221v1_random:63226-63248 GCTCAGAGGAGACGTGCAGTGGG - Intergenic
969179275 4:5424622-5424644 GCTCTCAGGAGACCTGAAGTGGG - Intronic
969642015 4:8404621-8404643 TCTCAGAAGAGACAGGCAGAAGG + Intronic
970959713 4:21857632-21857654 GCTCAGAGGAGACCCACAGTGGG - Intronic
971079782 4:23196003-23196025 GCTCAGAGGAGACCCACAGTGGG - Intergenic
971092463 4:23361153-23361175 GCTCTCAGGAGACCTGCAGTGGG - Intergenic
971478131 4:27091079-27091101 GCCCACAGGAGACCACCAGTGGG - Intergenic
971560345 4:28072108-28072130 GCTCACAGGAGTGAGGCAGTGGG + Intergenic
971714041 4:30153055-30153077 GCTCAGAGGAGACCTACAGTGGG + Intergenic
971834612 4:31747796-31747818 GAGGAGAGGAGACCTGCAGTAGG + Intergenic
971938743 4:33188307-33188329 GCTCCAAGGAGACCGGCAGTAGG + Intergenic
972072612 4:35039278-35039300 GCTCAGAGGAGACCTGCAGTTGG - Intergenic
972106487 4:35494612-35494634 GCAGAGAGGAGACCCACAGTGGG - Intergenic
972106513 4:35494761-35494783 GCTCAGAGGAGACCCACAGTGGG - Intergenic
972128715 4:35802423-35802445 GCTCAGAGGAAACCCACAGGGGG - Intergenic
972645879 4:40967179-40967201 GCTCAGAGGAGACCCACAGTAGG - Intronic
973026872 4:45284053-45284075 GCAGAGAGGAGACCTGGAGTGGG + Intergenic
973362451 4:49177936-49177958 GCTCAGAGGAGAACTGCAGTGGG + Intergenic
973398649 4:49618925-49618947 GCTCAGAGGAGAACTGCAGTGGG - Intergenic
974235840 4:59180022-59180044 GCTGAGAGGAGACCCACAGTCGG - Intergenic
974278439 4:59758899-59758921 GCTCAGAGAAGACCTGCAGTGGG + Intergenic
974285091 4:59855539-59855561 GCTCAGAGGACACCTGCAGTGGG + Intergenic
974308556 4:60174238-60174260 ACTCAGAGGAGAATTGCAGTGGG + Intergenic
974420175 4:61662858-61662880 GCAGAGAGGAGACCCACAGTGGG - Intronic
974420184 4:61662928-61662950 GCAGAGAGGAGACCCACAGTGGG - Intronic
974420192 4:61662998-61663020 GCTCAGAGGAGACTTACAGTGGG - Intronic
974432609 4:61817482-61817504 GTGGAGAGGAGACTGGCAGTGGG - Intronic
974432619 4:61817552-61817574 GCTCTCAGGAGACCTGAAGTGGG - Intronic
974644165 4:64671344-64671366 GCTCAGAGGAGATCTGCATTGGG + Intergenic
974683448 4:65194638-65194660 GCTCACAGGGGACCTACAGTGGG + Intergenic
974686792 4:65241869-65241891 GCAGAGAGGAGACCCGTAGTGGG + Intergenic
974894910 4:67927044-67927066 GCTCACAGGAGACCCACAGTGGG - Intronic
975008537 4:69321107-69321129 GCAGAGAGGAGACCTGAAGTGGG - Intronic
975044452 4:69783998-69784020 GCTCAGAGAAGACCCACAGTGGG - Intronic
975221151 4:71814233-71814255 GCTCAGAGGAGAACTGCAGTGGG + Intergenic
975254303 4:72215858-72215880 GCTCATAGGAGACCCACAATGGG + Intergenic
975321373 4:73012419-73012441 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
975913716 4:79298172-79298194 GCTCAGGGGAGACCTGCAGGGGG - Intronic
976097780 4:81527814-81527836 GCTCAGAGGAGACCTGCAGTGGG + Intronic
976647392 4:87400201-87400223 GCTCAGAGGAGACCCACAGTGGG - Intergenic
976675416 4:87697464-87697486 GCTCAGTGGAGAACTGCAGCAGG + Intergenic
976679876 4:87745147-87745169 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
976815803 4:89147977-89147999 GCTCAGAGGAGACCTGCGGTGGG + Intergenic
976921443 4:90449200-90449222 GCTAAGAGGAGACCCACAGTGGG + Intronic
976922634 4:90457577-90457599 GCTGAGAGAAGACCCACAGTGGG + Intronic
977033958 4:91925239-91925261 GCTCAGAGCGGACCCACAGTGGG - Intergenic
977359143 4:95981462-95981484 GCTCAGAGGAAACCCACAGCAGG - Intergenic
977568831 4:98609608-98609630 GCTCAGAGTAGACCTGCACCTGG - Intronic
977645879 4:99410786-99410808 GCTCAGAGGAGACTTGCAGTGGG + Intergenic
977816200 4:101416605-101416627 GCTCAGAGGAGACCCATGGTAGG + Intronic
978229851 4:106385509-106385531 GCTCAGAGAAGACCCACAGTGGG + Intergenic
978248524 4:106604043-106604065 ACTCAAAGGAGACCCGCAGTGGG + Intergenic
978248537 4:106604112-106604134 GCAGAGAGGAGACCCACAGTGGG + Intergenic
978249318 4:106610975-106610997 GCTCAGAGGAGACCCACAGCAGG - Intergenic
978301011 4:107269844-107269866 GCTGAGAGGACACCTACAGTAGG + Intronic
978498510 4:109384871-109384893 GCTCAGAGGAGACTCACAGTGGG - Intergenic
978663377 4:111154301-111154323 GCTCAAAGGAGACCTGCAATGGG + Intergenic
979462910 4:121003775-121003797 GCTCAGAGGAGACCCACAGGGGG - Intergenic
979637832 4:122977790-122977812 GCTCTCAGGAGACCTGAAGTGGG + Intronic
979637896 4:122978200-122978222 GCAGAGAGGAGACCTGGAGTGGG + Intronic
979637909 4:122978270-122978292 GCGGAGAGGAGACCCGGAGTGGG + Intronic
980180291 4:129393083-129393105 GCTCAGAGGAAACTCGCAGTGGG - Intergenic
980450269 4:132960118-132960140 GCTCAGAGGAGACCCAGAGTGGG - Intergenic
980671184 4:136008909-136008931 GCTCAGAGGAGACCCATATTGGG - Intergenic
980729771 4:136811271-136811293 GCTCAGAGGAAACCTGCAGAGGG + Intergenic
980730909 4:136823647-136823669 GCTCAGAGAAGACCGGCATTGGG + Intergenic
980745000 4:137001360-137001382 GCTCAGAGGAGACCCGTAGTGGG - Intergenic
980750023 4:137076714-137076736 ACTCAGAGGAAATCCGCAGTGGG + Intergenic
981889162 4:149715731-149715753 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
982171408 4:152665324-152665346 GCTCAGGGGAGGCCAGAAGTGGG - Intronic
982545252 4:156724958-156724980 GCTGAGAGAAGACCTGCACTGGG - Intergenic
982611096 4:157575086-157575108 GCTCAGAGGAGACCTGCATTGGG - Intergenic
983000532 4:162408918-162408940 GCTCAGAGGAGACCCACAGTGGG + Intergenic
983069673 4:163253893-163253915 GCTCTCAGGAGACCTGGAGTGGG + Intergenic
983125802 4:163949631-163949653 GCTCAGAGGAGACCCACAGTGGG + Intronic
983380076 4:166981143-166981165 GCCCAGAGGAGACCCATAGTGGG + Intronic
983491965 4:168399035-168399057 GCTCAGAGGAGACCTGCAGTGGG - Intronic
983651512 4:170040851-170040873 GCTCAGAGGAGAGCCACAGTGGG - Intergenic
983715496 4:170776708-170776730 GCTCAGAGGAGACCCACAGTGGG - Intergenic
983784607 4:171715768-171715790 GCTCAGAGGAGGCCTGCAGGGGG - Intergenic
984102079 4:175499116-175499138 GCTCAGAGGAGATCCACAGGGGG + Intergenic
984296700 4:177862390-177862412 GCTCAGAGGAGACCCACAGTTGG - Intronic
984325254 4:178242448-178242470 GCTCAGAGGAGACCTGTAGTGGG - Intergenic
984534778 4:180960667-180960689 GCTCAGGGGAGACGGGGGGTGGG - Intergenic
984763816 4:183384406-183384428 GCAGAGAGGAGACCCGCACTGGG - Intergenic
984763855 4:183384687-183384709 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1202759788 4_GL000008v2_random:99409-99431 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
986490914 5:8289228-8289250 TCTCAGAGCAGCCCTGCAGTGGG - Intergenic
986503817 5:8429425-8429447 GCTTAGAGGAGACCCACAGTAGG + Intergenic
986923564 5:12717687-12717709 GCTCAGAGGAGACTCACAGTGGG - Intergenic
987815971 5:22901534-22901556 GCAGAGAGGAGATCTGCAGTGGG + Intergenic
987951893 5:24686982-24687004 GCTCAGAGGAGAACCACAGTGGG + Intergenic
987951913 5:24687122-24687144 GCAGAGAGGAGACCCACAGTGGG + Intergenic
988093176 5:26568925-26568947 GCTCAGAGAAGACCTACAGGGGG + Intergenic
988565865 5:32319839-32319861 GCTCAGAGGAGATCCACAGTGGG + Intergenic
989339203 5:40354912-40354934 GCTCAGAGGAGACCTGCAGTAGG - Intergenic
989520716 5:42396943-42396965 GCTCAGAGGAGACCAACATTGGG - Intergenic
990023789 5:51160342-51160364 GCTTAGAGGAGACCAGCAGTGGG - Intergenic
990878811 5:60517708-60517730 GCTCCCAGGAGACCTGAAGTGGG - Intronic
992029640 5:72708814-72708836 ACGGAGAGGAGACCTGCAGTGGG + Intergenic
992693071 5:79259017-79259039 ACTCAGAGGAGACCTGTAGTGGG + Intronic
994245344 5:97470825-97470847 GCTCAGAGGAGATGTGCAGTGGG + Intergenic
994593924 5:101807117-101807139 GCAGAGAGGAGACCCACAGTGGG - Intergenic
994641017 5:102410142-102410164 GCTCAAAGGAGAACTGCAGTGGG + Intronic
994692344 5:103034448-103034470 GCTGAGAGGAGACCCACAGTGGG + Intergenic
994692354 5:103034516-103034538 GCTGAGAGGAGACCCACAGTGGG + Intergenic
994891350 5:105640021-105640043 GCAGAGAGGAGACCTACAGTGGG - Intergenic
995744917 5:115393360-115393382 GCTCAGAGGAGACCCGCAGTGGG + Intergenic
995927048 5:117386684-117386706 GTGCAGAGGAGACCTGAAGTTGG - Intergenic
995927058 5:117386754-117386776 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
996923790 5:128799727-128799749 GCTCAGAGGAGACCCACAGTAGG + Intronic
997960493 5:138316850-138316872 GCTCAGAGGAGACCCACAGGGGG - Intronic
998480515 5:142459114-142459136 GCTGAGAGGAGACCCACAGTGGG + Intergenic
1000001497 5:157142869-157142891 TCCCGGAGGAGACCGGAAGTTGG - Exonic
1000266317 5:159641374-159641396 GCTCAGAGGAGATCTGCAGTGGG - Intergenic
1000385965 5:160675105-160675127 GCCCAGGGGAGACCAGCAGCTGG + Intronic
1000426265 5:161094144-161094166 GCTCAGAGGAGACATGCAGTAGG - Intergenic
1001544592 5:172563227-172563249 GCTCATAGCAGACCTGCAGAGGG - Intergenic
1002831259 6:823448-823470 GCTGAGAGGTGACGGGAAGTGGG - Intergenic
1002986279 6:2192290-2192312 GCTCAGAGAAGACCCACAGTGGG - Intronic
1003439021 6:6122370-6122392 GCAGAGAGGAGACCCACAGTGGG - Intergenic
1004304560 6:14488115-14488137 GCTCAGAGGAAACCCGCACTGGG - Intergenic
1005021413 6:21422997-21423019 GCTCAGAGGAGACCGACAGTGGG + Intergenic
1005594758 6:27368455-27368477 GCAGAGAGGAGACCTGCAGTGGG - Intergenic
1006348022 6:33498639-33498661 GGTCAGAGGAGACCCACAGTGGG - Intergenic
1006463766 6:34178902-34178924 GCTCTCAGGAGACCCGGAGTGGG + Intergenic
1006500989 6:34458614-34458636 GCTCAGAAGAGACCCGCAGTGGG - Intergenic
1006753817 6:36397054-36397076 GCTCAGAGGAGATCCGCAGTGGG - Intronic
1006808584 6:36805406-36805428 GCTCTGAGGATACTGGGAGTGGG + Intronic
1006867560 6:37221815-37221837 GCTAAAAGGAGACTCGCAGTGGG + Intronic
1008330612 6:50240482-50240504 GCTCAGAGGAGACTCATAGTGGG + Intergenic
1009243336 6:61204789-61204811 GCAGAGAGGAGACCTACAGTGGG + Intergenic
1009846855 6:69145680-69145702 GCTCAGAGGAGACCTTCAGTGGG + Intronic
1010341171 6:74754940-74754962 GCTCAGAGGAGACCAGCAGAGGG - Intergenic
1010489095 6:76452789-76452811 GCAAAGAGGAGACCCGAAGTGGG + Intergenic
1010519734 6:76818175-76818197 GCAGAGAGGAGACCCACAGTGGG - Intergenic
1010519743 6:76818243-76818265 AGACAGAGGAGACCTGCAGTGGG - Intergenic
1010846909 6:80720433-80720455 GCAGAGAGGAGACCCACAGTGGG - Intergenic
1011795608 6:90948249-90948271 GCTCAGAAGAGACCCGCAGTGGG - Intergenic
1011822586 6:91271198-91271220 GCTCTCAGGAGACCTGTAGTGGG + Intergenic
1012052214 6:94360958-94360980 GCCCAGAGAAGACCCGCAGTGGG + Intergenic
1012122415 6:95384696-95384718 GCTCAGAGGAGACCCACATTGGG - Intergenic
1012169519 6:96001788-96001810 GCTCAGAGGAGACCCACAGAGGG + Intergenic
1012709598 6:102582268-102582290 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1012749490 6:103140037-103140059 GCTCCCAGGAGACCTGAAGTGGG + Intergenic
1012752814 6:103184509-103184531 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1013086324 6:106860996-106861018 GCTCAGGGGAAACCTGCAGTAGG + Intergenic
1013235997 6:108198426-108198448 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1013375598 6:109510642-109510664 GCTCAGAGGAGACCCACAGTGGG - Intronic
1013693170 6:112668572-112668594 GCACAGAGGAGGCCCACAGTGGG - Intergenic
1013709381 6:112879798-112879820 GCTCAGAGGAGACCCGCAGGGGG + Intergenic
1014227118 6:118861540-118861562 GCTCTCAGGAGACCCGAAGTGGG + Intronic
1014384766 6:120786469-120786491 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1014391716 6:120872708-120872730 GCTGAGAGGAGATCCACAGTGGG - Intergenic
1014391727 6:120872778-120872800 GCTAAGAAGAGACCCACAGTGGG - Intergenic
1014418704 6:121214912-121214934 GCTCTCAGGAGACCAGAAGTGGG + Intronic
1015434785 6:133172988-133173010 GCTCAGTGGAGACCTGCATTGGG - Intergenic
1015455599 6:133423968-133423990 GCTCAGAGGAGACCCACAGTGGG + Intronic
1015663787 6:135604221-135604243 GCTCAGAGGAAACCCTCAGAGGG - Intergenic
1016237904 6:141890469-141890491 GCTCAGAGGATACCTGCATTGGG - Intergenic
1016339633 6:143049273-143049295 GCTCGGAGGAAACCCACAGTGGG + Intergenic
1017162696 6:151380765-151380787 GCGCAGAGGAGACCAGCAAGTGG - Intronic
1017420446 6:154267633-154267655 GCTCAGAGAAGACCCATAGTGGG + Intronic
1017522309 6:155213274-155213296 GCTCAGAGGAAACCCACAGTGGG + Intronic
1017524433 6:155230185-155230207 GCTCAGGGGAGAGCAGGAGTGGG - Intronic
1018062557 6:160102229-160102251 ACACAGAGGAGACAGGCAGGAGG - Intronic
1018064907 6:160118118-160118140 GCTCAGAGGACACCTGCATTGGG + Intergenic
1018126924 6:160690995-160691017 GCTCACAGGAGAGCGGCCATAGG - Intergenic
1019144018 6:169965328-169965350 GCTCAGATTAAACAGGCAGTGGG + Intergenic
1019296030 7:275899-275921 GCTCAGCGGAGACCCTCTGTGGG + Intergenic
1019897868 7:3997312-3997334 GCCCAGAGGAGCCCCGCAGTGGG + Intronic
1020474811 7:8582520-8582542 GCAGAGAGGAGACCTGCAGTGGG + Intronic
1020586829 7:10079345-10079367 GCTCAGAGGAGACCTGCAGATGG - Intergenic
1020649311 7:10855329-10855351 GCTCAGAGGAGACCCGCAGTGGG - Intergenic
1020761297 7:12270304-12270326 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1020812405 7:12863763-12863785 GTTCGGAGGAGACCTGCAGTGGG + Intergenic
1020832522 7:13109926-13109948 GCAGAGAGGAGACCCACAGTGGG + Intergenic
1021097292 7:16548168-16548190 CCTTAGAGAAGACCTGCAGTGGG - Intronic
1021677715 7:23097739-23097761 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1022391923 7:29950764-29950786 GCAGAGAGGAGACCTGTAGTGGG - Intronic
1022423383 7:30245610-30245632 GCTGAGAGGAAACCAGCAGTGGG + Intergenic
1023699983 7:42883223-42883245 GCTCAGAGGAGACCTGCAATGGG + Intergenic
1024782079 7:52863073-52863095 GCTCAGAGTAGAAGGGCTGTTGG - Intergenic
1027008647 7:74722206-74722228 GCTCAGAGCGCACCGGCAGTGGG - Intronic
1027333667 7:77126463-77126485 GCTCAGAGGAGACCCACAGTGGG + Intronic
1027575232 7:79922640-79922662 GCTCAGAAGAAACCCACAGTGGG - Intergenic
1027779795 7:82507325-82507347 GCTCAGAGAAGACCTGCTGGAGG + Intergenic
1027924878 7:84447628-84447650 GCTCTTAGGAGACCCGAAGTGGG - Intronic
1028035086 7:85972200-85972222 GCTCTGAGAAGACCTGAAGTGGG + Intergenic
1028054536 7:86225949-86225971 GCAGAGAGGAGACCTGGAGTGGG + Intergenic
1028136809 7:87230926-87230948 GCTCTCAGGAGACCCGAAGTGGG - Intergenic
1028527358 7:91801037-91801059 GCTCAGAGGAGACCCACAGAGGG + Intronic
1028816833 7:95156585-95156607 GCACACAGGAGACCTGCAGAGGG + Intronic
1029494930 7:100891357-100891379 GCTCAGTCCAGACGGGCAGTGGG + Intronic
1029782126 7:102744869-102744891 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1030484456 7:110148777-110148799 GCAGAGAGGAGACCCACAGTGGG + Intergenic
1030612957 7:111708537-111708559 TTTCAGAGGAGAGAGGCAGTAGG + Intergenic
1031242024 7:119257964-119257986 GCTCAGAGGAGACCTGCAGGTGG + Intergenic
1031265339 7:119573169-119573191 GCTCAGAGAAGACCTGCAGTGGG - Intergenic
1031743672 7:125467851-125467873 GCTCAGAGGAGACCAGCACTGGG + Intergenic
1031836996 7:126690752-126690774 ACTCAGAGGAGACCTGCAGTGGG + Intronic
1031921921 7:127608696-127608718 GCTCTCAGAAGACCGGAAGTAGG + Intergenic
1032016028 7:128380949-128380971 TCTCAGAGGAGACAGGGAGGAGG - Intergenic
1032658283 7:133955254-133955276 GCTCAGTGGAGACCTGCAGTGGG + Intronic
1032858566 7:135857735-135857757 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1032919230 7:136527214-136527236 GCTCACAGGAGACCCAGAGTGGG + Intergenic
1034101759 7:148456980-148457002 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
1034101771 7:148457050-148457072 GCAGAGAGGAGACCTGGAGTGGG + Intergenic
1034210359 7:149357873-149357895 GCTCAGAGGAAACCCACAGTCGG + Intergenic
1034899675 7:154899849-154899871 GTTCAGAGGATGCTGGCAGTGGG - Intergenic
1036497325 8:9281104-9281126 GCTCAGGGGAGACCAGTAGGGGG + Intergenic
1037150291 8:15627349-15627371 GCTCAGAGGGAACCTGCAGTGGG - Intronic
1037269823 8:17114619-17114641 GCTCTGAGGACACCAGCACTTGG - Intronic
1037553928 8:20004143-20004165 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1039182264 8:34880167-34880189 GCTCAGAGGAGGCCCGCAGTGGG + Intergenic
1039211073 8:35215280-35215302 GCTCAGAGGACACCAGCATTGGG + Intergenic
1040536734 8:48317097-48317119 ACTCAGAGGACACAGGCAGTGGG + Intergenic
1040661900 8:49583626-49583648 GCTCAGAGAAGACCTTCAGTGGG - Intergenic
1040881717 8:52212278-52212300 GCCCAGAACAGACCGGCTGTGGG + Intronic
1041189863 8:55342531-55342553 GATCAGAGCAGAGAGGCAGTGGG - Intronic
1041205457 8:55494558-55494580 GCTCAGAGGAGACCCAAAGTGGG + Intronic
1041274434 8:56142677-56142699 GCAGAGAGGAGACCTGGAGTGGG - Intergenic
1041965433 8:63669973-63669995 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1042336996 8:67639863-67639885 GCTCAGAGGAGACCTATAGTGGG + Intronic
1042396122 8:68293334-68293356 ACTCGGAGGAGACATGCAGTGGG - Intergenic
1042439644 8:68810765-68810787 CCTGAGAGGAGACCCACAGTGGG + Intronic
1043082495 8:75784255-75784277 GCTCAGAGAAGATTTGCAGTGGG + Intergenic
1043087119 8:75849122-75849144 GCTCAGAGAAGATTTGCAGTGGG + Intergenic
1043180538 8:77082605-77082627 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
1043798600 8:84578562-84578584 GCTCTCAGGAGACCTGAAGTGGG + Intronic
1044008637 8:86965802-86965824 GCTCAGAGGAGACCTGCAGCAGG + Intronic
1044409614 8:91868640-91868662 GCTCAGAGGAGACCCACAGGAGG - Intergenic
1044412627 8:91901646-91901668 GCTCAGAGGAGACCCAGAGTGGG + Intergenic
1044774903 8:95677909-95677931 GCTCAGAGGAGACTCACAGTGGG + Intergenic
1044962389 8:97543236-97543258 GCTCAGAGGAGACCTGCAATGGG - Intergenic
1045300684 8:100907902-100907924 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1045363530 8:101454513-101454535 GCACAAAGGAGACCTGGAGTTGG - Intergenic
1045873403 8:106950590-106950612 GTGGAGAGGAGACCTGCAGTGGG - Intergenic
1045888066 8:107123230-107123252 GCTCTCAGGAGACCTGGAGTGGG - Intergenic
1046140465 8:110083780-110083802 ACTCAGAGGAGACCCCCAGTGGG - Intergenic
1046186994 8:110734533-110734555 GCTCTAAGGAGACCCACAGTGGG + Intergenic
1046195755 8:110860842-110860864 GCAGAGAGGAGACCCACAGTGGG - Intergenic
1046195772 8:110860978-110861000 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1046395215 8:113632379-113632401 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1046407289 8:113790889-113790911 GCTCTGAGGAGACCCACAGTTGG + Intergenic
1046503703 8:115111223-115111245 GCTCAGAAGAGACCTGCAGTGGG + Intergenic
1046674616 8:117094360-117094382 GCTCAGAGGAGACCCGCAGTGGG + Intronic
1047318328 8:123754853-123754875 GTGGAGAGGAGACCTGCAGTGGG + Intergenic
1047543904 8:125797266-125797288 GCTCTCAGGAGACCTGAAGTAGG + Intergenic
1048339074 8:133525159-133525181 GCTTTCAGGAGACCTGCAGTGGG + Intronic
1048513321 8:135081493-135081515 GTTCAGAGGAGAAATGCAGTTGG - Intergenic
1048547897 8:135404370-135404392 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1048547920 8:135404510-135404532 GCAGAGAGGAGACCTGGAGTGGG + Intergenic
1048693019 8:136989285-136989307 GCAGAGAGGGGACCCGCAGTGGG + Intergenic
1048938703 8:139378030-139378052 CCTCAGAGGAGACCTGCAGAAGG + Intergenic
1049603433 8:143518539-143518561 GCCCAGAGGAGAGCGGCATGTGG - Intronic
1049646793 8:143739204-143739226 GCCCAGAGGACGCCGGCATTTGG - Intergenic
1049824069 8:144655640-144655662 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1050182379 9:2934690-2934712 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1050547812 9:6723557-6723579 GTGCAGAGGACACCAGCAGTGGG - Intronic
1050725547 9:8644325-8644347 GCTCAGAGGAGACCCATAGTGGG - Intronic
1050937264 9:11413963-11413985 GCTCAGAGGAGATCCACAGTGGG - Intergenic
1050942009 9:11471894-11471916 GCTGAGAGGAGACCACCAGGGGG - Intergenic
1051001790 9:12290943-12290965 GCTTAGGGGAGACCCACAGTGGG - Intergenic
1051221296 9:14851118-14851140 GCCCAGAGGAGCCAGGCAGGTGG - Intronic
1051355214 9:16234404-16234426 GCAGAGAGGAGACCTGGAGTGGG - Intronic
1052466769 9:28839485-28839507 GCAGAGAGGAGACCAGGAGTGGG + Intergenic
1052466779 9:28839558-28839580 GCTGAGAGGAGACCCACAATGGG + Intergenic
1052552501 9:29969467-29969489 GCTTAGAGACGACCTGCAGTGGG + Intergenic
1052580587 9:30349589-30349611 GCTCTGAGGAGACCTGAAGTGGG + Intergenic
1052652344 9:31321113-31321135 GCTCAGAGGAGACCCACACTGGG + Intergenic
1053445101 9:38146582-38146604 GCTCAGAGGAGACCCGCAGTGGG - Intergenic
1053617437 9:39782095-39782117 GCTCAGAGAAGACCCACAGTGGG - Intergenic
1053619129 9:39798413-39798435 GCTCAGAGGAGACCCGCAGTGGG + Intergenic
1053875619 9:42541458-42541480 GCTCAGAGAAGACCCACAGTGGG - Intergenic
1053877284 9:42557762-42557784 GCTCAGAGGAGACCCGCAGTGGG + Intergenic
1053895381 9:42736926-42736948 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1053897029 9:42753175-42753197 GCTCAGAGAAGACGCACAGTGGG + Intergenic
1054234409 9:62543960-62543982 GCTCAGAGGAGACCCGCAGTGGG - Intergenic
1054236080 9:62560266-62560288 GCTCAGAGAAGACCCACAGTGGG + Intergenic
1054265028 9:62909016-62909038 GCTCAGAGGAGACCCGCAGTGGG - Intergenic
1054266729 9:62925342-62925364 GCTCAGAGAAGACCCACAGTGGG + Intergenic
1054550222 9:66594796-66594818 GCTCAGAGAAGACCCACAGTGGG + Intergenic
1054702615 9:68428536-68428558 GCTCAGGGGAAACAGGCATTAGG - Intronic
1055645495 9:78357981-78358003 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1055890865 9:81122409-81122431 GCTCAGAGGTGACCTGCAGTGGG + Intergenic
1056002281 9:82230113-82230135 GATCAGAGGAGCCCAGGAGTTGG + Intergenic
1056191983 9:84194086-84194108 GCTCAGAGGAGACCCACAATGGG + Intergenic
1056261509 9:84853705-84853727 GCTGAGAGGACACGGGCAGGGGG - Intronic
1056462198 9:86818762-86818784 GCTCAGAGGAGACCTGGAGATGG - Intergenic
1056986174 9:91365017-91365039 GCTCGGAGGAGACCCGCAGTGGG - Intergenic
1058091983 9:100814798-100814820 ACTCAGAGGATACCAGCAGTGGG - Intergenic
1058510850 9:105714264-105714286 GCTCAGAGAAGACCCACAGTGGG - Intronic
1059104843 9:111502092-111502114 GCAGAGAGGAGACCTGGAGTGGG - Intergenic
1059104853 9:111502160-111502182 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1059401275 9:114071940-114071962 GCTTGGAGGGGACCTGCAGTGGG - Intronic
1061208314 9:129176924-129176946 GCTCCGAGGAGTCCGGCTGTCGG + Exonic
1061295715 9:129675638-129675660 GCGAGGGGGAGACCGGCAGTGGG - Intronic
1061579989 9:131530834-131530856 GCTCCGAGGAGCCCGGCCGGCGG + Intronic
1061743196 9:132722287-132722309 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
1062184778 9:135212140-135212162 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1062329156 9:136029276-136029298 GCTGAGAGGAGACCCACAGTGGG - Intronic
1062629560 9:137457765-137457787 TCTCAGAGGAGCCCAGCATTAGG - Exonic
1203691579 Un_GL000214v1:47624-47646 GCTCAGAGGAGACCTGCAGTCGG + Intergenic
1203751813 Un_GL000218v1:87181-87203 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1203710487 Un_KI270742v1:93150-93172 GCTCAGAGGAGACGTGCAGTGGG - Intergenic
1203540564 Un_KI270743v1:84304-84326 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1203612277 Un_KI270749v1:20863-20885 GCTCAGAGGAGACCCATAGTGGG + Intergenic
1203644716 Un_KI270751v1:56567-56589 GCTCAGAGGAGACCTGCAGTCGG - Intergenic
1186223596 X:7375024-7375046 GTGGAGAGGAGACCTGCAGTGGG + Intergenic
1186770606 X:12814424-12814446 GTTCTGAGGAGACTGTCAGTTGG - Intronic
1188756569 X:33969796-33969818 GCTCAGAGGAGACGCTCAGTGGG - Intergenic
1189023929 X:37371314-37371336 GCTCAGAGGAGACCCACATTGGG - Intronic
1190369550 X:49727601-49727623 GCTCAGAGAAGACCCATAGTGGG - Intergenic
1190621176 X:52288274-52288296 GCAGAGAGGAGACCTGGAGTGGG - Intergenic
1190621213 X:52288484-52288506 GCAGAGAGGAGACCTGGAGTGGG - Intergenic
1190681793 X:52832003-52832025 GCTCAGAGGAGATCCGCAGTGGG - Intergenic
1191016396 X:55813995-55814017 GCTCAGAGGAGACCCAAAGTGGG - Intergenic
1192265286 X:69533488-69533510 GCTCAGAGGGGACCCACAGTGGG + Intergenic
1193468690 X:81875016-81875038 GCTCAGAGAAGACCTGCAGTGGG + Intergenic
1193554213 X:82933028-82933050 GCTCAAAAGAGACCCGCAGTGGG - Intergenic
1193743127 X:85243008-85243030 GCTCATAGTAGACCAGGAGTCGG - Intergenic
1194212238 X:91082839-91082861 GCAGAGAGGAAACCTGCAGTGGG - Intergenic
1194379411 X:93175564-93175586 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1194380354 X:93182272-93182294 GCTCAGAGGAGACCCTCAGTGGG - Intergenic
1194891456 X:99384481-99384503 GCTCTCAGGAGACCCACAGTGGG + Intergenic
1195178485 X:102333793-102333815 GCTCAGAGGATACCCGAAGGGGG + Intergenic
1195180379 X:102353290-102353312 GCTCAGAGGATACCCGAAGGGGG - Intergenic
1195655079 X:107325226-107325248 GCTCAGAGAAGACCTGCAGGGGG - Intergenic
1197035703 X:121870763-121870785 GCTGAGAGGAGACCCACAGTGGG - Intergenic
1197342268 X:125288049-125288071 GCTCAGAGCTGACCTGCAATAGG - Intergenic
1197378311 X:125709449-125709471 GCTGAGAGGGGCCAGGCAGTGGG - Intergenic
1197378458 X:125710216-125710238 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1197407056 X:126065741-126065763 GCAGAGAGGAGACCTGAAGTGGG - Intergenic
1197421324 X:126238828-126238850 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1197501215 X:127244297-127244319 GCTCAGAAAAAACCTGCAGTCGG + Intergenic
1197609496 X:128622922-128622944 GCTCAGAGGAGGCCCACATTGGG + Intergenic
1197795937 X:130299064-130299086 ACTCAGAGGAGACCCGCAGTGGG + Intergenic
1199103860 X:143838296-143838318 GCCCAGAGGGGACCTGCAGTGGG - Intergenic
1199187946 X:144939064-144939086 GCTCAGAGGAGACCTACAGTGGG + Intergenic
1199494946 X:148442344-148442366 GCTCAGAGCAGATGGGCAGAAGG + Intergenic
1199861072 X:151800989-151801011 GCTCAGAGGAGACCCGCAGGGGG + Intergenic
1200424827 Y:3009221-3009243 GCTCTCAGGAGACCTGCAGTGGG + Intergenic
1200424838 Y:3009291-3009313 GCAGAAAGGAGACCTGCAGTGGG + Intergenic
1201165467 Y:11204801-11204823 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1201370123 Y:13254131-13254153 TCTCAGAGCAGCCTGGCAGTTGG - Intronic
1201383513 Y:13413165-13413187 GCTGAGAGGGGACCTGAAGTGGG - Intronic
1202018145 Y:20434213-20434235 GCTCAGAGAAGACCTGCAGTTGG + Intergenic