ID: 1146145491

View in Genome Browser
Species Human (GRCh38)
Location 17:30412601-30412623
Sequence CCTGCGAGGCTGCAGCCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 2, 2: 9, 3: 76, 4: 325}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146145491_1146145498 27 Left 1146145491 17:30412601-30412623 CCATGAGGCTGCAGCCTCGCAGG 0: 1
1: 2
2: 9
3: 76
4: 325
Right 1146145498 17:30412651-30412673 GAATAAGGCTTCGTGGGTGTGGG 0: 1
1: 0
2: 18
3: 190
4: 682
1146145491_1146145494 12 Left 1146145491 17:30412601-30412623 CCATGAGGCTGCAGCCTCGCAGG 0: 1
1: 2
2: 9
3: 76
4: 325
Right 1146145494 17:30412636-30412658 TGCTGCAGTAGCAGTGAATAAGG 0: 1
1: 1
2: 17
3: 179
4: 501
1146145491_1146145497 26 Left 1146145491 17:30412601-30412623 CCATGAGGCTGCAGCCTCGCAGG 0: 1
1: 2
2: 9
3: 76
4: 325
Right 1146145497 17:30412650-30412672 TGAATAAGGCTTCGTGGGTGTGG 0: 1
1: 0
2: 16
3: 144
4: 506
1146145491_1146145496 21 Left 1146145491 17:30412601-30412623 CCATGAGGCTGCAGCCTCGCAGG 0: 1
1: 2
2: 9
3: 76
4: 325
Right 1146145496 17:30412645-30412667 AGCAGTGAATAAGGCTTCGTGGG 0: 1
1: 3
2: 29
3: 338
4: 1138
1146145491_1146145495 20 Left 1146145491 17:30412601-30412623 CCATGAGGCTGCAGCCTCGCAGG 0: 1
1: 2
2: 9
3: 76
4: 325
Right 1146145495 17:30412644-30412666 TAGCAGTGAATAAGGCTTCGTGG 0: 1
1: 2
2: 30
3: 336
4: 1141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146145491 Original CRISPR CCTGCGAGGCTGCAGCCTCA TGG (reversed) Intronic
900362760 1:2297881-2297903 CCTGCCAGGCTGCAGCCACGGGG - Intronic
900400909 1:2472535-2472557 CCTGGGATGCGGCTGCCTCAGGG + Intronic
900462371 1:2807812-2807834 GCAGCGAGGCTGCGGCGTCAGGG - Intergenic
900550220 1:3250852-3250874 CCTGCGAGGGTACAGCCTGGGGG + Intronic
900732666 1:4272432-4272454 CCTAGGAGGCTGCAGCCTAAAGG + Intergenic
901447771 1:9318652-9318674 CCTCCGAGGCACCAGCCACACGG - Intronic
901595089 1:10378576-10378598 CCTGAGAGTCAGCAACCTCAAGG - Intronic
902332847 1:15739076-15739098 CCTGTGAGGCTGCGGCGCCATGG - Intronic
903709927 1:25315953-25315975 GCTCCAAGCCTGCAGCCTCATGG - Intronic
903717188 1:25376453-25376475 GCTCCAAGCCTGCAGCCTCATGG + Intronic
905355470 1:37380787-37380809 CCTGCAAGGCAGCAGCCTGGCGG - Intergenic
907242557 1:53088828-53088850 CCTGCGTGGCTCCACCCTCCTGG + Intronic
907826071 1:58017896-58017918 AGTGCTGGGCTGCAGCCTCAAGG - Intronic
908347108 1:63245326-63245348 TCTGCGAGGATGCAGCAACAAGG - Intergenic
908401175 1:63774188-63774210 CAGGCGAGGCTGCAGCCAGAGGG + Exonic
908775251 1:67633281-67633303 TCTCTGAGGCTGCAGCCTCCTGG - Intergenic
908859295 1:68465050-68465072 CCTGAGGCGCTGAAGCCTCAGGG + Intergenic
909707818 1:78608088-78608110 CCTGCTACGCTGCAGCTTGATGG + Intergenic
910915117 1:92279876-92279898 CCTGCGAGGCTGCAGCTAGACGG + Intronic
912186362 1:107281045-107281067 CCTGAAAGGCTGCAGGCTCTTGG - Intronic
912386736 1:109274565-109274587 CCTGCCCGGGTGCAGCCTGAAGG - Exonic
913069557 1:115286492-115286514 CCTGAGTGTCTGCAGCTTCACGG + Exonic
915316757 1:155033155-155033177 CCAGCGAGGCTGTAGCCTGTGGG - Exonic
915976125 1:160390622-160390644 CCTGCAAGGCAGCAGCCTGGAGG - Intergenic
916785680 1:168085495-168085517 CCTCTCAGGCTGCAGCCCCACGG + Exonic
917276234 1:173334783-173334805 CTTGAAAGGCAGCAGCCTCAAGG - Intergenic
917294518 1:173504948-173504970 CCTGGTAGGCTGCAGCCACATGG - Intronic
917323899 1:173812087-173812109 CCTGCGAGACAGCAGCCTCGTGG + Intronic
920993147 1:210959629-210959651 CCTGTGAGGCTGCAGCCTGTGGG - Intronic
922800835 1:228364120-228364142 CCTGCTTGGCTCCAGCCTGACGG - Intronic
923209060 1:231786868-231786890 CCTGGCAGGATGCAGCCTCCTGG + Intronic
1063221821 10:3975820-3975842 GCTGCAAGGCTGCAGCCTGGAGG + Intergenic
1064057024 10:12106435-12106457 CCTGCGTGGCCCCAGCCTCGTGG + Intronic
1065076926 10:22089675-22089697 CCTGCAAGGCAGCAGCCTGGGGG + Intergenic
1066139526 10:32489483-32489505 ACTGAGAGACTGCAGCTTCAGGG + Intronic
1067278263 10:44853007-44853029 CCTCCAAGGCTGAAGGCTCAAGG - Intergenic
1067335455 10:45359145-45359167 CCTGCGAGGCTGCAGCTGGGTGG + Intergenic
1067432468 10:46253141-46253163 CCGGTGAGGCTGGAGCCCCAGGG + Intergenic
1068670351 10:59716093-59716115 CCTGGGAGGCTGAACCCTTATGG - Intronic
1069923399 10:71831455-71831477 CCTGCGAGACTGCAGGTCCAGGG - Intronic
1071066721 10:81644690-81644712 CCTGCAAGGCTGCAGCCTGGCGG - Intergenic
1071758463 10:88572917-88572939 CCTGAGATTCTGCAGCTTCAAGG - Exonic
1075087211 10:119421744-119421766 CCTGAGAGGCTTCAGCTTCTTGG - Intronic
1075574790 10:123570515-123570537 CCTGAGAGGCTCAAGCCTCAGGG + Intergenic
1076529756 10:131136447-131136469 CCTCCGTGGCTGCTGCCCCAGGG + Intronic
1076737725 10:132466205-132466227 CCAGCCTGACTGCAGCCTCATGG - Intergenic
1076834451 10:133014115-133014137 CCTGCGTGGCTGCAGCCATCTGG - Intergenic
1077044483 11:538321-538343 CCTGCCAGCCTCGAGCCTCATGG - Intronic
1077366996 11:2165305-2165327 GCTGCACGGCCGCAGCCTCAGGG + Exonic
1077551913 11:3204234-3204256 CCTGGGTGCCTGCAGCCTCCGGG - Intergenic
1077551924 11:3204276-3204298 CCTGGGTGCCTGCAGCCTCCGGG - Intergenic
1078321623 11:10340016-10340038 CCTGCAAGGCTGAAGCCTGGTGG + Intronic
1078690009 11:13570239-13570261 CCTGTGAGGCTGCAGCCTGGCGG + Intergenic
1079224779 11:18595790-18595812 CCTGCCAGTTGGCAGCCTCATGG - Intergenic
1081308730 11:41545118-41545140 CCTGAGAGGTTGCAGCCTGGTGG + Intergenic
1082001500 11:47395698-47395720 CCTGCCAGGCAGCAGCCCCCGGG + Intergenic
1082939195 11:58686164-58686186 CCTGTGTGTGTGCAGCCTCAAGG + Intronic
1083501734 11:63115287-63115309 CCTGCAAGGCAGTAGCCTCATGG - Intronic
1084174522 11:67416349-67416371 CCTCCCAGGATGCAGCCGCAGGG - Intronic
1084615588 11:70233802-70233824 CCTGCGAAGCTCCAGCCTTGGGG + Intergenic
1086442085 11:86838384-86838406 CCTGTGGGGCTGCAGCTTGATGG + Intronic
1089560396 11:119340541-119340563 CCTGCGAGCGCTCAGCCTCAGGG - Intronic
1090904810 11:131065843-131065865 CTTCCGGGGCTGCAGCCACATGG - Intergenic
1091296235 11:134475766-134475788 CCTAGGAGGCCTCAGCCTCATGG - Intergenic
1092917678 12:13203121-13203143 CCAGCAAAGCTGCAGCCTCCTGG - Intronic
1093900422 12:24625342-24625364 CCTGCTAGGCTGCAGCCTGGCGG - Intergenic
1094430751 12:30367077-30367099 CCTGTGAGGCTGCAGCCTGGCGG - Intergenic
1094482324 12:30894771-30894793 CCTGCAAGGCTGCAGCCTGGCGG - Intergenic
1094807666 12:34107992-34108014 CCAGCGTGGCTGCGGCCCCATGG + Intergenic
1095140553 12:38657298-38657320 CCTGCGAGGCTGCAGCCTGGTGG + Intronic
1096030539 12:48410159-48410181 CCTGCGACACTGCAGCTTGATGG - Intergenic
1096219501 12:49820225-49820247 CCTGGGAGGCTGCACCTGCACGG + Intronic
1099410092 12:82314585-82314607 CCTGCAAGGCTGCAGCCTGGCGG - Intronic
1100464770 12:94835152-94835174 CCTCTGAGGCTGCAGGCTCTGGG + Intergenic
1102955888 12:117058844-117058866 CCTGCAAACCTGCAGCCTCTAGG - Intronic
1103963272 12:124622504-124622526 CCTGCTAGGGTCCTGCCTCAGGG + Intergenic
1104089900 12:125507606-125507628 CCAGCCATGCTGCTGCCTCAGGG - Intronic
1104915207 12:132260857-132260879 GCGGCCAGGCTGCAGCCGCACGG + Intronic
1105243965 13:18631266-18631288 CCTGAGAGGCTGCAGCCTGGTGG + Intergenic
1105330721 13:19412792-19412814 CCTGGGAGGCTGTAGCCTAAAGG - Intergenic
1105918795 13:24941566-24941588 CCTGGGAGGCTGTAGCCTAAAGG - Intergenic
1106406572 13:29479938-29479960 GTTGAGAAGCTGCAGCCTCATGG - Intronic
1106853128 13:33817097-33817119 CCTGGAAGGCTTCTGCCTCAGGG - Intergenic
1107126612 13:36853529-36853551 CCCCAGCGGCTGCAGCCTCAAGG - Exonic
1107482323 13:40795096-40795118 CTTGGGAGGCTGTAGCCTAAAGG - Intronic
1108624159 13:52211136-52211158 CCTGGGAGGCTGTAGCCTGAAGG - Intergenic
1108661891 13:52595287-52595309 CCTGGGAGGCTGTAGCCTGAAGG + Intergenic
1108797031 13:54044235-54044257 CCTGCGACACTGCAGCTTGACGG + Intergenic
1109465826 13:62729943-62729965 CCTGTGAGGATGCAGCCTGGTGG - Intergenic
1109816227 13:67588738-67588760 CCTGCAAGGCTGCAGCCTGGTGG + Intergenic
1111319822 13:86612532-86612554 CTGGCGAGGCTGCAGACTAAAGG - Intergenic
1111929288 13:94497276-94497298 CCTGGCAGGCTGGAGACTCAGGG - Intergenic
1113962799 13:114134461-114134483 GCTGGGAGCCTGCAGCCACAGGG + Intergenic
1114342578 14:21760462-21760484 CCTGCGATGCTGCGGCTTGATGG + Intergenic
1114743253 14:25119593-25119615 CCTGCCAGGTGGCAACCTCAAGG + Intergenic
1116105251 14:40494569-40494591 CCTGTGAGCCTGAAGACTCAAGG - Intergenic
1117400402 14:55354111-55354133 CATGGTAGGCTGCAGCCTCCAGG + Intronic
1118331400 14:64818524-64818546 CCAGTGAGGATGCTGCCTCAGGG - Intronic
1118559878 14:67067676-67067698 CCTGCCAGGCTGCAGCCTGGCGG - Intronic
1122279531 14:100613204-100613226 CCTTGGAGTCTGCAGCCTCAGGG - Intergenic
1122542811 14:102507421-102507443 CCGGCGTGGCTGCAGCCGCGTGG - Exonic
1122812123 14:104294242-104294264 CCTTGGAGGCTGCAGTCCCAAGG + Intergenic
1123013074 14:105358525-105358547 TCTCCCAGGCTGCAGCCCCAGGG - Intronic
1123553066 15:21400453-21400475 CCTGCATGGCTGCATCCTGATGG - Intergenic
1123589311 15:21837841-21837863 CCTGCATGGCTGCATCCTGATGG - Intergenic
1124142332 15:27088406-27088428 GCTGGGAGTCTGCAGCCCCAGGG + Intronic
1124608848 15:31193672-31193694 GGTTGGAGGCTGCAGCCTCAGGG + Intergenic
1124830954 15:33148686-33148708 CCTGCAAGGCTGAAGGCGCAAGG - Intronic
1126074502 15:44896259-44896281 CCTGCAAGGCTGCAGCCTGGTGG - Intergenic
1126101203 15:45119304-45119326 CCTGTGAGGCTGCATCCTGTGGG + Exonic
1127193727 15:56561810-56561832 CCGGCCAGGCTTCAGCCTCCAGG - Intergenic
1129115759 15:73364555-73364577 CCTGAGGGGCTGCAGCATCCTGG + Intronic
1129293297 15:74584910-74584932 CCAGGGAGCCTGCAGCCTGAGGG - Intronic
1129696171 15:77741710-77741732 CCACAGAGCCTGCAGCCTCAGGG - Intronic
1130360133 15:83176497-83176519 CCTGCAAATCTGCAGCCCCATGG + Intronic
1131055348 15:89371549-89371571 CCCTCGAGGCTGCGGGCTCAGGG + Intergenic
1131760396 15:95616482-95616504 CCAGCTGGGCTGAAGCCTCAAGG - Intergenic
1132034376 15:98469078-98469100 CCTTGAAGGCTCCAGCCTCATGG + Intronic
1202961414 15_KI270727v1_random:127673-127695 CCTGCATGGCTGCATCCTGATGG - Intergenic
1132855713 16:2043775-2043797 CCTGGGAGGATGCAGCCCCCAGG + Intronic
1133592585 16:7260533-7260555 CCTCCAAGGCTGCATCTTCAGGG + Intronic
1136363919 16:29799760-29799782 AATGAGAGCCTGCAGCCTCATGG + Exonic
1136377441 16:29873613-29873635 CCTGCCAGGGTACAGCCTCGAGG - Exonic
1136605767 16:31332256-31332278 CCTGCGAGCCTGCGGCCTGCTGG + Exonic
1137461508 16:48668363-48668385 CCTGCTAGGCTGCAGCCTGTCGG - Intergenic
1137792191 16:51184736-51184758 CTTGGGAGGTAGCAGCCTCAAGG + Intergenic
1138291059 16:55847096-55847118 CCAGGGAACCTGCAGCCTCATGG - Intronic
1138431413 16:56971552-56971574 CTTGTGAGGCTGCAGCCCAAAGG - Intronic
1139348619 16:66321316-66321338 CCTGCAGGACAGCAGCCTCATGG - Intergenic
1139960791 16:70716231-70716253 CCCCCGGGGCTGCAGCCTCATGG - Intronic
1140047960 16:71454952-71454974 CCTGGGCAGCTGCAGCCTCTGGG + Intronic
1140866466 16:79066704-79066726 CATGAGAGCCTGCCGCCTCAAGG + Intronic
1141141185 16:81497807-81497829 CCTCTGCTGCTGCAGCCTCAAGG + Intronic
1141922264 16:87143987-87144009 CCTGGGAGGCTGCAGACTCATGG + Intronic
1142164890 16:88581027-88581049 CCTGCATGCCTGCAGCCTCGTGG + Intronic
1142193118 16:88726958-88726980 CCTGCCAGGCCGGAGCGTCAGGG + Exonic
1142377001 16:89711598-89711620 CCAGCGAGGGTGCAGGCCCAGGG - Intronic
1143394205 17:6579243-6579265 CCTACTAGGCTGTAGACTCAGGG - Exonic
1143949746 17:10623170-10623192 CCTGCGGGGCTGCATGCTCTTGG + Intergenic
1144185187 17:12789926-12789948 CCCGCGAGGCTGCATCCGCAGGG + Intronic
1144374422 17:14625559-14625581 CCTATGAGGCTCCAGCCTCACGG - Intergenic
1144763290 17:17719376-17719398 CCAGCCTGGCTGCTGCCTCAGGG + Intronic
1145268600 17:21392454-21392476 CTTGAGCAGCTGCAGCCTCATGG - Intronic
1145892259 17:28425458-28425480 CCTGCAAGGCTGCAGCCAGTGGG + Intergenic
1146145491 17:30412601-30412623 CCTGCGAGGCTGCAGCCTCATGG - Intronic
1148048761 17:44759198-44759220 CCAGCGCCGCAGCAGCCTCATGG - Exonic
1148950327 17:51305340-51305362 TCTGCGAGGCTGCAGGCTGGTGG + Intergenic
1149225519 17:54465623-54465645 CCTGTGAGGCTGCAGCCTGGTGG - Intergenic
1149812442 17:59690359-59690381 CATGCTAGGATGCAGCCTGAGGG - Intronic
1150830330 17:68512723-68512745 GCTCCGAGTCTGCATCCTCAAGG + Intronic
1152029540 17:77833459-77833481 CATGTGAGGGTGCAGCCCCAAGG - Intergenic
1152331942 17:79678575-79678597 CCGGGGAGGCGGCAGCCGCAGGG - Intergenic
1152562166 17:81083989-81084011 CCTGCGGGGGGGCAGCCCCAGGG - Intronic
1152585301 17:81186640-81186662 CCTGGGAGGCTGAGGCCCCAGGG + Intergenic
1152606707 17:81295101-81295123 CCTTCGAGGCTGCCTCCTCCAGG - Exonic
1152623723 17:81379059-81379081 CCTGAGAAACTGCAGCCCCAAGG - Intergenic
1154444978 18:14428631-14428653 CCTGAGAGGCTGCAGCCTGGTGG - Intergenic
1155899311 18:31368513-31368535 CTGGCGAGGCTGCAGACTGAAGG + Intergenic
1156008417 18:32470392-32470414 CTCGCTGGGCTGCAGCCTCAAGG - Exonic
1156443851 18:37219549-37219571 CCTGCCAGGCTGCTGTCTCGCGG + Intronic
1156454113 18:37283219-37283241 CCTGGGTGGCTCCAACCTCAGGG - Intronic
1156471753 18:37381479-37381501 CCTGCAAGGCTCCCACCTCAAGG - Intronic
1156484780 18:37457748-37457770 CCTGCCAGGCCACAGCCTCCTGG - Intronic
1157561472 18:48649373-48649395 CCTGTGAGGCAGCAGCCTGGAGG + Intronic
1157794107 18:50559632-50559654 CCCGCGCGGCTGCAGCCGCCGGG - Intergenic
1158703708 18:59771753-59771775 CCTGTGAGGCAGCAGCCTGGTGG + Intergenic
1160160551 18:76466940-76466962 CCTGTGAGGCTGCAGAACCAGGG - Intronic
1160960641 19:1719150-1719172 CACGCGAGGCTGCAGCCCCAGGG + Intergenic
1161645467 19:5450832-5450854 CCAGCCAGGGTGCAGCCTCAGGG + Intergenic
1161663999 19:5564057-5564079 CCTGCAACGCTGCTGCCTCGAGG + Intergenic
1162096212 19:8311489-8311511 CCTGTGACACTGCACCCTCACGG - Exonic
1162728061 19:12701637-12701659 TCTGCGATGCTGTAGCCTCCTGG - Exonic
1163637563 19:18444493-18444515 CCTCCCTGGCTGCAGCCTCCGGG - Exonic
1163662665 19:18588121-18588143 CCTGCTATGCTCCAGGCTCAGGG + Intronic
1163697333 19:18770456-18770478 CCTGCTGGGCTGCAGACTTAGGG + Intronic
1165445678 19:35855875-35855897 CTTGAGAGGCTGGAGACTCAAGG - Intronic
1165809941 19:38606132-38606154 GCTGGGAGGCTGGGGCCTCAGGG - Intronic
1166952483 19:46438814-46438836 CCAGGCAGGCTCCAGCCTCAGGG - Intergenic
1166952678 19:46440228-46440250 CCAGGCAGGCTCCAGCCTCAGGG - Intergenic
1167359956 19:49024639-49024661 CCTCCGAGGCTTCGGCCCCATGG - Intronic
1167362522 19:49037665-49037687 CCTCCGAGGCTGCGGCCTCGGGG - Intergenic
1167366174 19:49056044-49056066 CCTCCGAGGCTGCGGCCCCGCGG - Exonic
1168115044 19:54217668-54217690 CCTGTGAGGCTGCAGCCAAATGG - Intronic
1168120737 19:54251360-54251382 CCCGTGAGGCTGCAGCCAAATGG - Intronic
1168170538 19:54585515-54585537 CCTGCGATGCTGCAGCTGGATGG - Intronic
1168177673 19:54636281-54636303 CCCGTGAGGCTGCAGCCAAATGG + Intronic
925020149 2:562635-562657 CCTGCGAGGCTGCAGCGTGGGGG + Intergenic
925020164 2:562680-562702 CCTGCGGGGCTGCAGCATGGGGG + Intergenic
925020177 2:562726-562748 CCTGCGGGGCTGCAGCATGGGGG + Intergenic
925197719 2:1940197-1940219 CCTGGCAGGGTGCAGCCACAGGG - Intronic
925197731 2:1940283-1940305 CCTGGCAGGGTGCAGCCACAGGG - Intronic
925197765 2:1940541-1940563 CCTGGCAGGGTGCAGCCACAGGG - Intronic
925339612 2:3127066-3127088 CCTGCCCGGCTGCTGCCTCAGGG - Intergenic
927027946 2:19089657-19089679 CCAGCAAGGCTGCAGCCTGGCGG + Intergenic
927090511 2:19707224-19707246 CCAGAGAGGCAGCAGCCCCAGGG + Intergenic
927909967 2:26890484-26890506 CCTGCAGGGCTTCAGCCTCAGGG - Intronic
930840193 2:55837266-55837288 CCTGCGAGGCTGCAGCCTGGCGG - Intergenic
931159124 2:59668752-59668774 CCTGCTAGGCTGCAGAGTCAAGG + Intergenic
932377557 2:71251146-71251168 CCTGCAAGGCTGCAGCCTGGCGG - Intergenic
934617079 2:95778867-95778889 CCTGCGAGGTGGCAGCCTTGTGG + Intergenic
934643814 2:96045692-96045714 CCTGCGAGGTGGCAGCCTTGTGG - Intergenic
934837231 2:97601786-97601808 CCTGCGAGGTGGCAGCCTTGTGG - Intergenic
935088387 2:99870360-99870382 CCTACGTGGCTGCAGAGTCAGGG - Intronic
935765744 2:106366274-106366296 CGTGCTCTGCTGCAGCCTCAGGG - Intergenic
936272613 2:111060510-111060532 CCTGTGATGCTGCACCATCAGGG - Intronic
936649865 2:114413724-114413746 CCTGCGATGCTGCAGCTGGATGG - Intergenic
936775339 2:115965742-115965764 CCTGCAAGGCTGCAGCCGGGCGG - Intergenic
937025325 2:118692849-118692871 CCTGCCAGGCAACAGGCTCAGGG + Intergenic
937268995 2:120635400-120635422 CCAGCCACGCAGCAGCCTCAAGG - Intergenic
937320366 2:120957135-120957157 CCTCCGAGGCTGGCCCCTCATGG + Intronic
938244000 2:129763560-129763582 CCTGAGAGCCTGGAACCTCAGGG + Intergenic
938477988 2:131633713-131633735 CCTGAGTGGCTGCCGCCTGAGGG + Intergenic
939795739 2:146642221-146642243 CCTGCGAGGCAGCAGTCTGGTGG + Intergenic
941810509 2:169751117-169751139 CCTGGGTGGCTGGAGCCTCTGGG + Exonic
942065799 2:172270456-172270478 CCTGTGAGGCTGCAGCCTGGTGG - Intergenic
942441783 2:176044482-176044504 CCTGAGAGGTTGAAGCCTCAGGG - Intergenic
944314292 2:198268858-198268880 GCTGGGAGGCTGGAGACTCAGGG - Intronic
945716103 2:213359497-213359519 CCTGCGAGGCTGCAGCCTGGTGG - Intronic
946464883 2:219903063-219903085 GCTGTGAGGCTGGAGACTCAGGG + Intergenic
946794069 2:223330905-223330927 TCTGTGAGGCTGCAGCCTGGCGG + Intergenic
947055674 2:226099215-226099237 CATGTGAGGTTGCAGCCTGAAGG - Intergenic
947379085 2:229527551-229527573 CCTGCCAGGCTGGTGTCTCAAGG + Intronic
947440589 2:230117840-230117862 CCTGCGATGCTGCAGCTTGATGG - Intergenic
947811048 2:233004211-233004233 CCTGCAGGGCTGCAGGGTCAGGG - Intronic
948995329 2:241575429-241575451 CCTGCTAGTCAGCAGCCTCAGGG - Intergenic
1168829964 20:840489-840511 CCTGCAGGGCTGCAGTCTCATGG + Intronic
1169795830 20:9461677-9461699 CCAGCCAGGTTGCTGCCTCACGG - Intronic
1169861694 20:10159457-10159479 CCTGCAATGCTGCAGCTTGATGG + Intergenic
1170184384 20:13571859-13571881 CCAAGGAGGCTCCAGCCTCAGGG + Intronic
1170543393 20:17411450-17411472 TCTGCAAGGCAGCAGCCTGATGG + Intronic
1170901396 20:20466627-20466649 CCTGTGCTCCTGCAGCCTCAGGG - Intronic
1171022225 20:21596121-21596143 CCTGCCAGTCTCCTGCCTCAAGG + Intergenic
1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG + Intronic
1171510244 20:25676543-25676565 TGGGCGAGGCTTCAGCCTCAAGG - Exonic
1172389640 20:34558438-34558460 CGGGCCAGGCTGCAGCCCCACGG - Intronic
1173136191 20:40441316-40441338 CTTGAGGGGCTGCAGTCTCATGG - Intergenic
1175392628 20:58636698-58636720 CCTGCCACACTCCAGCCTCACGG + Intergenic
1175958007 20:62621258-62621280 CCTGCCAGGCTGCGACCCCAGGG - Intergenic
1175965089 20:62656411-62656433 ACTGCGTGGCTGAAGCCTCGAGG + Exonic
1175965809 20:62659699-62659721 CCTGCAAGGCTGCAGCCAGGCGG - Intronic
1176035454 20:63034094-63034116 CCTGGGAGGCTGCAGGCTCTGGG + Intergenic
1176451009 21:6861238-6861260 CCTGAGAGGCTGCAGCCGGGTGG + Intergenic
1176742295 21:10615835-10615857 CCTGGGAGGCTGTAGCCTAAAGG + Intergenic
1176829177 21:13726289-13726311 CCTGAGAGGCTGCAGCCGGGTGG + Intergenic
1177078346 21:16607006-16607028 CCTCAAAGGCAGCAGCCTCAAGG + Intergenic
1180564170 22:16649055-16649077 CCTGGGAGGCTGTAGCCTAAAGG + Intergenic
1180944121 22:19680364-19680386 CTTGCGAGGCTGCTGCCTCCTGG - Intergenic
1180968938 22:19804953-19804975 CCTGCGGGGTTGCAGCCTTGGGG + Intronic
1180977207 22:19854993-19855015 CCTGCGAGGTAGCGGCCACACGG - Intergenic
1181464282 22:23102407-23102429 CCAGGGAGGATGCAGCCACAAGG + Intronic
1181796121 22:25312337-25312359 ACTGTGAGGCTCCAGGCTCAGGG - Intergenic
1182549193 22:31091826-31091848 CCGAGGAGGCTGCAGCATCAAGG + Exonic
1182579016 22:31292649-31292671 CCTGCGAGGCCGCATCCCCAGGG + Intergenic
1183365292 22:37403579-37403601 CCTGGGAGGCTGCGGCCTCGGGG + Intronic
1184069390 22:42138580-42138602 CCTGCGAGGCCCGAGCCTCCCGG + Intergenic
1184194638 22:42918742-42918764 CCAGGGAGGCTGGAGCCTCAGGG + Intronic
1184223960 22:43118500-43118522 CCAGCCTGGCTGCAGGCTCAGGG + Intronic
1185368564 22:50447995-50448017 CCTGCCAGACTCCAGACTCACGG + Intronic
949347619 3:3091137-3091159 TCTGCTAGGCTGAAGGCTCAGGG + Intronic
950149512 3:10675783-10675805 CATGCAAGGCCACAGCCTCAGGG + Intronic
951012160 3:17693504-17693526 CCAGCCAGGCTGCCGCCTCGTGG - Intronic
953849013 3:46450915-46450937 CCTGCCAGGCAGCAGCTGCACGG - Intronic
954513856 3:51153222-51153244 CCTGCGAGGCAGCAGCGTAGCGG - Intronic
956477396 3:69637068-69637090 CCTGTGAGGCTGCAGCCTGGTGG - Intergenic
957917855 3:86709089-86709111 CCTGGGAAGCTGCAGCCTGGCGG - Intergenic
960065399 3:113366981-113367003 CCTGTGAGGCTGCAGCCCGGCGG + Intronic
960836056 3:121908103-121908125 CCTACTAGGCTGCTGCCTCGTGG + Intronic
960890526 3:122443224-122443246 CCTGCAAGGCTGCAGCCTGGCGG + Intronic
960900295 3:122547775-122547797 CCTGGGAGGCTGAGGCTTCAGGG + Intronic
961339956 3:126211509-126211531 GCTGCCAGCCTGCAGCCTCCAGG - Intergenic
962137123 3:132746896-132746918 CCTGCGAGGCAGCGGCCTGGCGG - Intergenic
962627113 3:137236568-137236590 CCTGCGAGGATGCAGTGTAAAGG + Intergenic
967728991 3:192889529-192889551 CCCTAGAGGCTGCAGCCTCAGGG - Intronic
968082136 3:195853933-195853955 CCTGAGTGGCAGCAGCATCAAGG - Intergenic
968489428 4:882122-882144 CCTGCGTCCCTGCAGCCACAGGG - Intronic
968517932 4:1022672-1022694 GCTCCGAGGCTGGAGCCTGACGG - Intronic
968543121 4:1178343-1178365 CCTGCGAGTCTGAAGTCTCAAGG - Intronic
969322638 4:6422018-6422040 CCTGAGACGCTGCAGCCGGATGG + Intronic
969330714 4:6472311-6472333 CCTGCTAGGCTGCGGCGGCATGG - Intronic
969431939 4:7160500-7160522 CCTGAGACGCAGCAGCCCCAAGG - Intergenic
969473139 4:7401584-7401606 CCTGCTGTGATGCAGCCTCAGGG + Intronic
969691395 4:8705993-8706015 CCTGTGACGCTGCAGCTTAAAGG + Intergenic
970756474 4:19433033-19433055 CCTGGGAGGCAGCAGTCGCAGGG - Intergenic
974307294 4:60157687-60157709 CCTACAAGGCTGCAGCCTGGTGG + Intergenic
974348907 4:60718764-60718786 CCTGCAAGGCTTCAGCATTATGG - Intergenic
974566911 4:63589999-63590021 CCTGCGATGCTGCAGCTTGATGG + Intergenic
974871760 4:67652946-67652968 CCTGCGAGGCTGCAGCCTGGCGG + Intronic
975203266 4:71616186-71616208 CCTGCAAGGTTGCAGCCTGGTGG + Intergenic
975291194 4:72679732-72679754 CCTGCAATGCTGCAGCTTGATGG + Intergenic
975844017 4:78506472-78506494 CCAGCCAGGCTACAGCCTCGCGG + Intronic
976658340 4:87512567-87512589 CCTGCAAGGTTCCAGCCACATGG - Intronic
976760086 4:88539341-88539363 CCTGCGAGGCTGCAGCCTCGGGG + Intronic
978464541 4:108994376-108994398 CCTGCGAGGCTGCAGCTTGATGG + Intronic
978494020 4:109339999-109340021 CCAGCCAGGCTGCTGCCTCACGG - Intergenic
978735356 4:112077992-112078014 CCTGCAAGGCTGCTACCTAATGG + Intergenic
978928949 4:114287431-114287453 TCTGTGAGGCTGCAGCCTGGCGG + Intergenic
979017463 4:115452432-115452454 CCTGTGAGACTGCAGCCTGGCGG - Intergenic
979462687 4:121001734-121001756 CCTGCGAGGCTGCAGCCAGGTGG - Intergenic
985005908 4:185535379-185535401 CCTGAGAGCCTGAAGCCCCAGGG + Exonic
985337157 4:188908591-188908613 CCTGTCAGGCTGAAGACTCAGGG - Intergenic
985587372 5:747736-747758 CCTGAGAGGCCACAGCCTCGGGG + Intronic
985601924 5:839828-839850 CCTGAGAGGCCACAGCCTCGGGG + Intronic
985790760 5:1925901-1925923 ACTGAGAGGCCGGAGCCTCAGGG - Intergenic
986105915 5:4659091-4659113 CCCGCAATGATGCAGCCTCATGG - Intergenic
986357046 5:6938826-6938848 CCTGGGAGCCTGCAGCCTGGAGG - Intergenic
987175149 5:15300294-15300316 CCGGCGAGGATGCAGCACCAAGG + Intergenic
987179904 5:15356487-15356509 ACTGCAAGGCTGCAGCCTGGTGG + Intergenic
988441669 5:31241014-31241036 TCAGCCAGGCTGCAGCCCCAAGG + Intronic
990713105 5:58606318-58606340 CCTGCAAGGTGGCAGCCTGATGG + Intronic
990869994 5:60420955-60420977 CCTGCGAGGCAGCAGCCTGGTGG + Intronic
993591497 5:89800823-89800845 CCTGTGATGCTGCAGCTTGATGG + Intergenic
995269876 5:110207959-110207981 CTTGCCAGGCAGCTGCCTCAGGG + Intergenic
996275394 5:121660297-121660319 CCTGCGAGGCAGCAGTCTGGCGG + Intergenic
998401838 5:141852483-141852505 GCTGGGAGGCTGGAGACTCAGGG - Intergenic
998415850 5:141945689-141945711 CCTCCGTGGCTGCAGCATCCGGG + Exonic
1001347792 5:170922540-170922562 ACTGCGATGCTGCAGCTTGACGG - Intronic
1001679327 5:173544509-173544531 CCTGCCATGCCTCAGCCTCAGGG - Intergenic
1001770903 5:174295129-174295151 CCTGCCAGGCTGGAGGCTCAGGG + Intergenic
1003515964 6:6818907-6818929 CCTGAGAGGCTGCCTCCTCTTGG - Intergenic
1003610544 6:7610896-7610918 CCTATGAGGCTGCAGGCACAGGG - Exonic
1003971013 6:11299259-11299281 CCTGCAACGCTGCAGCTTGAGGG + Intronic
1005599547 6:27412216-27412238 TCTGCGAGGTTGCACGCTCAGGG + Intergenic
1007433152 6:41787884-41787906 CTTGCGAGGCTGGCGCCTCAGGG + Intronic
1010667170 6:78644192-78644214 CCTGCGACACTGCAGCCTGGTGG - Intergenic
1010820670 6:80411687-80411709 CCTGCGAGGCTGCAGCCTGATGG - Intergenic
1010997661 6:82551727-82551749 CCTGCGACGCTGCAGCCTGGTGG - Intergenic
1011288613 6:85752051-85752073 CTTGTGAGGCTGCAGCCTGGCGG + Intergenic
1012209280 6:96500028-96500050 CCTGCAAGGCAGCAGCCTGCTGG - Intergenic
1012597996 6:101062399-101062421 CCTGCGATGCTGCACCTTGACGG + Intergenic
1013436645 6:110116454-110116476 CCTGTGACGCTGCAGCTTGACGG + Intronic
1015046280 6:128779967-128779989 CCTGCAAGGTTGCAGCCTGGTGG - Intergenic
1015257111 6:131190896-131190918 CCTGGGAGGTTACAGTCTCATGG - Intronic
1016584923 6:145673696-145673718 CCTGAGAGGCTGCAGCCTGGTGG + Intronic
1016655641 6:146515409-146515431 CCTGTGAGGCTGCAGCCTGGCGG - Intergenic
1017213123 6:151879147-151879169 CCTCTCAGGCTGCAGCCTCCCGG - Intronic
1017457572 6:154615813-154615835 CCTGGGAGGTTGCTGCCTCCAGG + Intergenic
1018208637 6:161459256-161459278 CCTGCCAGTCTGCAACCTAAAGG + Intronic
1019277852 7:185210-185232 CCTGTGAGGCCGCAGCCTGAGGG - Intergenic
1019455506 7:1124890-1124912 CCTGCCAGGCCTCAGCCTCCGGG + Intronic
1019848137 7:3527484-3527506 CCTGAGACACTCCAGCCTCAGGG - Intronic
1019879007 7:3842006-3842028 CCTCCATGGCTGTAGCCTCAGGG + Intronic
1020136759 7:5592216-5592238 GCTGTGGGGCTGAAGCCTCAAGG + Intergenic
1022136021 7:27449270-27449292 CCTCCGAGGCTGCAGCCTGGTGG - Intergenic
1022504614 7:30902541-30902563 CCTGAGGAGCTGCAGCCCCAGGG + Intergenic
1024506407 7:50165840-50165862 CCTCCCAGGAAGCAGCCTCATGG + Intergenic
1026095561 7:67343683-67343705 GCTGGGAGGTTGAAGCCTCAGGG + Intergenic
1029207362 7:98877975-98877997 CCTCCGAGGCTGGATCCACATGG - Intronic
1029520281 7:101056481-101056503 CCTCCGAACCTGAAGCCTCAGGG - Intronic
1030936753 7:115594211-115594233 CCTGTGAGGCTGCAGCCTGGTGG + Intergenic
1035233923 7:157484256-157484278 CGGGTGAGGCTGCAGCCTCTGGG - Intergenic
1035291455 7:157841857-157841879 CCTGCGGGCCTGCAGCCTGCAGG + Intronic
1035448256 7:158957619-158957641 CCAGCTGGGCTGCAGCCACACGG + Intergenic
1036176157 8:6540497-6540519 TCTGTGAGCGTGCAGCCTCATGG + Intronic
1036570253 8:9974109-9974131 CCTGCGGGTCTGCAGCCAGATGG - Intergenic
1037129368 8:15389117-15389139 CCTGTCAGTCTGCAGCCTGAGGG + Intergenic
1037450676 8:19013627-19013649 GCTCCGGGGCCGCAGCCTCAGGG + Exonic
1038784358 8:30597458-30597480 CCTGGGGGGCTGCAGACACAGGG - Intronic
1040556703 8:48485958-48485980 CCTGTGAGGCTGCAGCCTGGCGG + Intergenic
1040567920 8:48583037-48583059 CCTGTGAGGCTGAGGCCGCAGGG - Intergenic
1041349878 8:56937687-56937709 CCTGCGACACTGCAGCTTGATGG + Intergenic
1041778244 8:61548432-61548454 CCAGAGAGACTGCAGCCTAAGGG - Intronic
1041951695 8:63510480-63510502 CCTGCAAAGCTGCAGCTTGACGG - Intergenic
1045157450 8:99492590-99492612 CCTGCGAGGCAGGAGCCTGGCGG - Intronic
1046880911 8:119307179-119307201 CCTGCAAGGCTGAAGCCTACTGG + Intergenic
1047440483 8:124873119-124873141 CGTGCAATGCTGCAGCCTCCTGG + Intergenic
1048461612 8:134626004-134626026 CCTGAGAGCCAGCAGCCGCAGGG + Intronic
1048503959 8:135004096-135004118 CCAGCCAGCCTGCAGCCTAATGG + Intergenic
1049372587 8:142274825-142274847 CATGCGAGGACGCAGCCTCAAGG + Exonic
1049412775 8:142480875-142480897 CCTGCCTGGCTGCATCCACAGGG - Intronic
1049426919 8:142541829-142541851 CCTGCGAGGCCGCCACCTCCTGG - Intronic
1050387006 9:5101303-5101325 CCTGCCAGGCTGCTGCCTCACGG - Intronic
1051425572 9:16928293-16928315 CCTGCAAGGCTGCAGCAGGATGG - Intergenic
1056033737 9:82582441-82582463 CAGGTGAGGCTTCAGCCTCATGG + Intergenic
1057646216 9:96877449-96877471 CCCGCGTGGCTCCAGCCTCCTGG + Intergenic
1057801878 9:98195831-98195853 CCTGGAAGGCAGCAGCCCCAGGG + Intergenic
1059405058 9:114094264-114094286 CCTGCTTCCCTGCAGCCTCAGGG - Exonic
1060508744 9:124217002-124217024 TCTGCCAGGCTGCAGCCTTGGGG + Intergenic
1060526583 9:124324365-124324387 CCCGAGAGCCTGCAGCCTCAAGG + Intronic
1061005911 9:127928315-127928337 CCTGCAAGGCTCAAGTCTCAGGG + Intronic
1061015721 9:127980147-127980169 CCTTCGGGGCTTCAGACTCAGGG - Exonic
1061158218 9:128878014-128878036 CATGCCAGGCCGCAGCCTCTTGG + Intronic
1061807425 9:133144269-133144291 CCTGCGAGGCTGCAGGGGCCAGG - Intronic
1062430626 9:136525486-136525508 CCGGGAAGGCAGCAGCCTCACGG + Intronic
1203518172 Un_GL000213v1:23279-23301 CCTGAGAGGCTGCAGCCGGGTGG - Intergenic
1203736860 Un_GL000216v2:144986-145008 GCTGGGAGGCTGCAGGGTCACGG - Intergenic
1191711384 X:64152992-64153014 CCTGCAATGCTGCAGCTTGATGG + Intergenic
1191745057 X:64477675-64477697 CCTGCAAGACTGCGGCCTCGTGG - Intergenic
1192222397 X:69206297-69206319 CCTCCAAGGTTGCAGACTCAGGG + Intergenic
1192629026 X:72760721-72760743 CCTGCTATGCTGCAGCTTGACGG - Intergenic
1192652684 X:72960093-72960115 CCTGCTATGCTGCAGCTTGACGG + Intergenic
1192678840 X:73230242-73230264 CCTACCAGGCTGCTGCCACACGG - Intergenic
1193167212 X:78294703-78294725 CCTGTGAGGCTTCAGCCTGCTGG - Intronic
1194073055 X:89351013-89351035 CCTGCCAGGTTGCAGGTTCATGG + Intergenic
1195576031 X:106451555-106451577 CCTGAGAATCTGCAGCCTCAGGG - Intergenic
1195729268 X:107949273-107949295 CCTGCCAGGCTGCTGCCTCACGG + Intergenic
1195808374 X:108801222-108801244 CCTGTGAAGCTGCAGCCTGGTGG + Intergenic
1196579883 X:117366458-117366480 ACTGGGAGGCTCCAGACTCAAGG + Intergenic
1197959636 X:131989873-131989895 CCTGCAAGGCTGCAGCCTGGTGG + Intergenic
1199796216 X:151200221-151200243 CCTGCGAGGCAGCAGCCTGGTGG + Intergenic
1199968512 X:152841028-152841050 CCTGTGAGGCTGCAGCCTGGAGG - Intronic
1200164119 X:154024399-154024421 CCTGCGAGGCTGACTCCACATGG + Intronic
1200269726 X:154671055-154671077 CCTGCGAGGCAGCAACCTGGTGG - Intergenic
1200371391 X:155728533-155728555 CCTGCAAGGCTGCAGCCTGGAGG - Intergenic
1200398380 X:156004380-156004402 CATGTGAGGCTGAAGCCCCATGG - Intronic
1200727292 Y:6686753-6686775 CCTGCCAGGTTGCAGGTTCATGG + Intergenic
1200728444 Y:6702528-6702550 CCTGCCAGGTTGCAGGTTCATGG + Intergenic
1200808256 Y:7454886-7454908 CCTATGAGGCTCCACCCTCATGG - Intergenic
1201250993 Y:12057450-12057472 CCTCCGAGGCTGCAGCCAGGTGG + Intergenic
1201364279 Y:13186435-13186457 CCCACAAGGCTGCAGCCTCATGG - Intergenic
1201459497 Y:14206588-14206610 CCTGTGAGACTGCAGCCTGGTGG + Intergenic
1201938703 Y:19435303-19435325 CCTGCAAGGCTGCAGCCTGGTGG + Intergenic
1202054837 Y:20818874-20818896 CCTGCGATGCTGCAGCCTTACGG + Intergenic
1202600616 Y:26590017-26590039 CCTGGGCGGCTGTAGCCTAAAGG + Intergenic