ID: 1146146833

View in Genome Browser
Species Human (GRCh38)
Location 17:30426315-30426337
Sequence CTCCAATTCTCCTGCGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 121}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146146833_1146146836 13 Left 1146146833 17:30426315-30426337 CCAGCCACGCAGGAGAATTGGAG 0: 1
1: 0
2: 3
3: 12
4: 121
Right 1146146836 17:30426351-30426373 CAGTCTCCCTGAAGGCTCAGAGG 0: 8
1: 31
2: 44
3: 113
4: 409
1146146833_1146146839 19 Left 1146146833 17:30426315-30426337 CCAGCCACGCAGGAGAATTGGAG 0: 1
1: 0
2: 3
3: 12
4: 121
Right 1146146839 17:30426357-30426379 CCCTGAAGGCTCAGAGGTTAGGG 0: 14
1: 24
2: 49
3: 102
4: 316
1146146833_1146146835 5 Left 1146146833 17:30426315-30426337 CCAGCCACGCAGGAGAATTGGAG 0: 1
1: 0
2: 3
3: 12
4: 121
Right 1146146835 17:30426343-30426365 ACTCAAATCAGTCTCCCTGAAGG 0: 19
1: 54
2: 99
3: 118
4: 297
1146146833_1146146837 18 Left 1146146833 17:30426315-30426337 CCAGCCACGCAGGAGAATTGGAG 0: 1
1: 0
2: 3
3: 12
4: 121
Right 1146146837 17:30426356-30426378 TCCCTGAAGGCTCAGAGGTTAGG 0: 11
1: 31
2: 48
3: 105
4: 428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146146833 Original CRISPR CTCCAATTCTCCTGCGTGGC TGG (reversed) Intronic
900370698 1:2330856-2330878 GTGGAATTCTCCTGTGTGGCTGG + Intronic
900532745 1:3162732-3162754 CTCCAGTCCTCCTGTGTGGCAGG + Intronic
900602719 1:3509905-3509927 TTCCAGTGCTCCTGCGAGGCCGG - Exonic
901062028 1:6475966-6475988 CTCCAAGTCCACTGCGGGGCTGG + Exonic
902220116 1:14959258-14959280 CTCCACATCACCTGCGTGGAAGG - Intronic
902374243 1:16022841-16022863 CCCAAAGTCTCCTGGGTGGCAGG + Intronic
902379194 1:16044718-16044740 CCCAAAGTCTCCTGGGTGGCAGG + Intronic
904148911 1:28420137-28420159 CTCCCAGCCTCCTGAGTGGCTGG - Intronic
904692618 1:32305430-32305452 CTGCAATTCTCCTACATAGCTGG - Intronic
909959208 1:81818057-81818079 TCCCACTTCTCCTGAGTGGCTGG - Intronic
918542181 1:185644545-185644567 CTCCAGTTCTTCTGCATAGCTGG - Intergenic
922699688 1:227751482-227751504 CCTCAATCCTCCTGCCTGGCGGG - Intronic
1064226503 10:13490532-13490554 CTCCTGATCTCCTGCCTGGCAGG + Intronic
1064945020 10:20777883-20777905 CTCCCAGGCTCCTGAGTGGCTGG - Intergenic
1065864122 10:29898757-29898779 CTCCCATTTTCCTGCTTGGCGGG + Intergenic
1066403037 10:35093233-35093255 CTCCAGTTCTCCTATGTGACTGG + Intergenic
1067166710 10:43871137-43871159 CCCCAAGTCTCCAGCGGGGCCGG - Intergenic
1069836078 10:71308988-71309010 CTCCCAGTCTCTCGCGTGGCTGG + Intergenic
1074276014 10:112002725-112002747 CTTCAATCTTCCTGCTTGGCTGG + Intergenic
1074576163 10:114671579-114671601 CTGCAATTCTCCTACATTGCTGG - Intronic
1076631293 10:131853585-131853607 CTCCATTTCTCCTGAGTCCCTGG + Intergenic
1077629672 11:3802681-3802703 CTCCAATTCTGCTGCTTCTCTGG - Intronic
1083200564 11:61118756-61118778 CTCTAAGCCTCCTGCGAGGCGGG - Intronic
1084546077 11:69815801-69815823 CTCCAAGGCTCCTGTGTGCCCGG + Intronic
1087354943 11:97080861-97080883 CTCCAATTCTCCTGAATTTCTGG + Intergenic
1088831842 11:113543555-113543577 CTACAATTCTCCTCTGAGGCTGG + Intergenic
1089595990 11:119580549-119580571 CTCCAGTTCTCCCATGTGGCTGG + Intergenic
1092954549 12:13537711-13537733 ATTCAATTGTCCTGGGTGGCTGG - Exonic
1100001252 12:89838471-89838493 CTCCAATTGTTCTGTGTGGGTGG - Intergenic
1102461992 12:113105713-113105735 CTCCAAGAGTCCTGAGTGGCAGG - Exonic
1102863365 12:116355320-116355342 CTCCAACTCTCCTGTGCGGTAGG - Intergenic
1104494156 12:129220986-129221008 CTGGAATTCACCTGCATGGCTGG - Intronic
1105543026 13:21331161-21331183 CTCCAAATCTCCTCTGTGGGAGG - Intergenic
1107759715 13:43664985-43665007 CACAAAATCTCCTGCGGGGCTGG + Intronic
1113299100 13:108997174-108997196 GTCTCATTCTCCTGAGTGGCTGG - Intronic
1115532173 14:34337549-34337571 TTCCAAATCTCCTGAGGGGCTGG - Intronic
1117077759 14:52121801-52121823 TTCCAGTTCTTCTACGTGGCCGG + Intergenic
1117657618 14:57972737-57972759 CTCTCACTCTCCTGCCTGGCTGG - Intronic
1119647259 14:76356794-76356816 CTGCAATTGTTCTGCGAGGCTGG + Intronic
1121236429 14:92394488-92394510 CTCAAACTCTCCTGCGTGGCTGG - Intronic
1121282510 14:92709561-92709583 CCCCCATACTCCTGTGTGGCAGG + Intronic
1121953112 14:98189406-98189428 CACCACTTCTCCTGTGCGGCAGG + Intergenic
1126700903 15:51366794-51366816 AAGCAATTCTCCTGAGTGGCTGG - Intronic
1129020702 15:72514883-72514905 AAGCAATTCTCCTGAGTGGCTGG - Intronic
1129518330 15:76170540-76170562 CTCTAACTCTCCAGCGGGGCAGG - Intronic
1130771973 15:86933533-86933555 CTCCAGTTATCCTGTGTGTCTGG + Intronic
1131884024 15:96890250-96890272 CTACAATTCTTCTGGATGGCAGG - Intergenic
1135602548 16:23795731-23795753 CTCCAGTTCTCCCACGTGGCCGG + Intergenic
1135918356 16:26625988-26626010 CCCAAATTCTGCTGCGTGGATGG - Intergenic
1136867736 16:33770258-33770280 ATGCAATTCTCCTGTGTAGCTGG - Intergenic
1138436523 16:57003686-57003708 CTCCAGTTCTCCCATGTGGCAGG + Intronic
1141407884 16:83809403-83809425 CTTCAACTCTTTTGCGTGGCAGG - Exonic
1203104424 16_KI270728v1_random:1345945-1345967 ATGCAATTCTCCTGTGTAGCTGG + Intergenic
1203129090 16_KI270728v1_random:1616423-1616445 ATGCAATTCTCCTGTGTAGCTGG - Intergenic
1143539616 17:7561434-7561456 CTCCATTGCCCCGGCGTGGCAGG + Exonic
1143764593 17:9129241-9129263 TTCCAAGGCTCCTGAGTGGCTGG + Intronic
1145902196 17:28496364-28496386 CCCCAATTCTCCTGCTTCTCTGG - Intronic
1146146833 17:30426315-30426337 CTCCAATTCTCCTGCGTGGCTGG - Intronic
1147598815 17:41733661-41733683 CTCCTATCCTCCTGCGGGTCGGG - Intronic
1147880019 17:43647494-43647516 CTCCATATCTCCTGGCTGGCTGG + Intronic
1147898786 17:43769992-43770014 CTGGAACTCTTCTGCGTGGCTGG + Intronic
1150500247 17:65643730-65643752 ATCCACTTCTTCTGAGTGGCAGG + Intronic
1152189640 17:78880596-78880618 ATACAATTCTCCTGAGTAGCTGG - Intronic
1152714322 17:81891287-81891309 CTCCCACTCTCCGGCGCGGCCGG + Intronic
1154027521 18:10722876-10722898 CTCCAGTTCTCATGCCTTGCTGG - Intronic
1156094472 18:33512242-33512264 CTCCTAGTCTCCTGAGTAGCTGG + Intergenic
1161864953 19:6826857-6826879 CTCCATTTCCTCTGCTTGGCTGG - Intronic
1163819253 19:19486855-19486877 CTCCATGGCTCCTGCATGGCAGG - Intronic
1166323739 19:42036467-42036489 CTCCCAGCCTCCTGAGTGGCTGG + Intronic
926284051 2:11473302-11473324 CTCCAATTATCCCTCATGGCAGG + Intergenic
926561128 2:14418746-14418768 TTCTAATTCTCCTGGGTGTCTGG - Intergenic
926782457 2:16486218-16486240 CTCTAATTCTTCTGAGGGGCTGG - Intergenic
927472511 2:23386178-23386200 CTCCAGGTCTCCTGCCCGGCCGG - Intronic
928278414 2:29922177-29922199 CCCAAATTCTCCTGTGTGGACGG - Intergenic
928931110 2:36625402-36625424 CTCCAGTTCTTCTGTGTGGCTGG - Intronic
934571527 2:95375776-95375798 CTCCAATGATCCTGTGTGGCGGG - Intronic
936500160 2:113060517-113060539 CTCCAATGCTGCTGAGTCGCAGG - Intronic
941275281 2:163483250-163483272 CTCGAATTCTGCTGAGTGGCAGG - Intergenic
942578554 2:177392562-177392584 CTCGAACTCACCTGCTTGGCAGG + Intronic
948699159 2:239749646-239749668 CTCCCATCTTCCTGCTTGGCTGG + Intergenic
1168965393 20:1895240-1895262 CTCCATTTCTCCTGGGGGGCGGG + Intronic
1172802435 20:37585688-37585710 CTCCCAGTCTCCTGAGTAGCTGG + Intergenic
1173899036 20:46573402-46573424 CTCCAGTGCTCCTGTGGGGCTGG + Intronic
1174535720 20:51249653-51249675 CTGGAATTCTCCTATGTGGCTGG - Intergenic
1177702661 21:24658352-24658374 CTTCCATTCTTCTGCTTGGCTGG + Intergenic
1179567185 21:42256497-42256519 CTCCAGGTCACCTGCGTGCCTGG + Intronic
1181113504 22:20616329-20616351 CTCCAGATCTCCTGGGAGGCGGG + Intergenic
1181669411 22:24419212-24419234 CTCCATCTCTCCTGCCTGACAGG + Intronic
952920263 3:38279053-38279075 CTCACCTTCTCCTGCATGGCTGG + Intergenic
953746489 3:45577990-45578012 CTCCAGTTCTCTTGTGTGACTGG + Intronic
960844064 3:121990697-121990719 CTCCTATACTCCTGAGTAGCTGG + Intronic
962811229 3:138960902-138960924 CTCCATTTTTCCTGCCTGGAAGG + Intergenic
968621416 4:1604965-1604987 CTCCACATCTCCTGCTTGGCAGG + Intergenic
971414910 4:26416147-26416169 CTCAAATTTTAGTGCGTGGCAGG + Intronic
972750150 4:41980501-41980523 CTCCCAGTCTCCTGAGTAGCTGG + Intergenic
975555760 4:75663380-75663402 CGCTAAATCTCCTGAGTGGCTGG + Intronic
980252368 4:130334661-130334683 CTCCAATTCTCCTGCACAGCTGG - Intergenic
980384417 4:132068555-132068577 GTCTCATTCTCCTGAGTGGCTGG + Intergenic
986164277 5:5259935-5259957 CTCCACTTCTCCTGCCTGGGGGG + Intronic
986656367 5:10016766-10016788 CTGCAATGCTGCTGCTTGGCGGG - Intergenic
988904321 5:35770711-35770733 CTCCACCTCTCCTCTGTGGCTGG - Intronic
996705586 5:126494684-126494706 CAGCAATTCTCCTGAGTAGCTGG - Intronic
999393082 5:151208510-151208532 CCCCAAATCTGCTGAGTGGCTGG + Intronic
1000097767 5:157986410-157986432 CTCCACTTGTGCTGCTTGGCCGG - Intergenic
1001102668 5:168827084-168827106 CTCCAATTATCCCACGAGGCAGG + Intronic
1001913509 5:175540656-175540678 CTCCAAGCCTCCTGCCTGGCTGG - Intergenic
1006980109 6:38140770-38140792 CTACAAATCTCCTGTGTGGAAGG - Intronic
1013003553 6:106048928-106048950 CAGCAATTCTCCTGAGTAGCTGG + Intergenic
1016388968 6:143556308-143556330 CTCCAATGCTCCTGCGTGCCAGG + Intronic
1021885048 7:25129872-25129894 CTCCCATCCTTCTGCTTGGCTGG - Intergenic
1023279386 7:38554073-38554095 CTCCAATTCCCCTGCCTGGCTGG + Intronic
1029583850 7:101456997-101457019 CTCCAGTTCTCCCACGTGGCCGG - Intronic
1032326202 7:130930911-130930933 CCCCACTTCTCCATCGTGGCGGG + Intergenic
1034535421 7:151723024-151723046 CTCCAGTTCTCCTGCGGTGGAGG - Intronic
1035431461 7:158826131-158826153 CTGAAATTCTGCTGCGCGGCAGG - Intronic
1035947551 8:3982054-3982076 ACCCCATTCTCCTGCGTAGCTGG - Intronic
1038078457 8:24104353-24104375 CTCCAATCCTCCTGGCTGCCTGG + Intergenic
1040536509 8:48315652-48315674 CTCTCAGTCTCCTGAGTGGCTGG + Intergenic
1040855896 8:51947747-51947769 CTCCAGTTTTCCCACGTGGCTGG - Intergenic
1041952084 8:63515095-63515117 CTCCCATCCTTCTGCTTGGCTGG - Intergenic
1042397194 8:68306430-68306452 CTCCACCTCCCCAGCGTGGCAGG + Intronic
1042785633 8:72543871-72543893 ATCCAATTCTACTGTGTGGGTGG + Intronic
1043424531 8:80135427-80135449 CTCTAACTCTCCTGGGGGGCAGG - Intronic
1044919137 8:97149334-97149356 CTCCAGTTCTTCTGCATAGCTGG + Intronic
1045352101 8:101351200-101351222 CTGTAATTCTCCTGTGTGGAGGG - Intergenic
1049741352 8:144242533-144242555 CCCCAGCTCCCCTGCGTGGCAGG - Intronic
1050918151 9:11163227-11163249 CTCCCATCCTGCTGCTTGGCTGG + Intergenic
1051045639 9:12870088-12870110 CTACAAGTCTCCTGAGTAGCTGG + Intergenic
1052504556 9:29336340-29336362 CTCCAATTATCCTGCTTTGGAGG - Intergenic
1055951240 9:81731590-81731612 CTCCAATTCTACTGCATGCTAGG - Intergenic
1059378076 9:113901263-113901285 CTCAAGTTCTCCTGCGTCGTTGG + Intronic
1060320190 9:122551948-122551970 CTCCAATTCTCTTCCTTGGATGG - Intergenic
1186393369 X:9183085-9183107 CTCAAAGTCTCCTGGGTGCCAGG + Intergenic
1188909392 X:35826920-35826942 CTCCCATCCTTCTGCTTGGCTGG + Intergenic
1190689330 X:52900556-52900578 CTTCAATTCTCCTGTGCGGAAGG - Exonic
1190696653 X:52955236-52955258 CTTCAATTCTCCTGTGCGGAAGG + Intronic
1196615597 X:117763701-117763723 CTCCCATTATCCTGTGAGGCAGG + Intergenic