ID: 1146150624

View in Genome Browser
Species Human (GRCh38)
Location 17:30466665-30466687
Sequence GCCACTCTTAGGCCCCTTGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146150624_1146150626 -10 Left 1146150624 17:30466665-30466687 CCAACAAGGGGCCTAAGAGTGGC 0: 1
1: 0
2: 0
3: 13
4: 80
Right 1146150626 17:30466678-30466700 TAAGAGTGGCTGCCCCTGCTTGG 0: 1
1: 0
2: 0
3: 15
4: 145
1146150624_1146150627 -9 Left 1146150624 17:30466665-30466687 CCAACAAGGGGCCTAAGAGTGGC 0: 1
1: 0
2: 0
3: 13
4: 80
Right 1146150627 17:30466679-30466701 AAGAGTGGCTGCCCCTGCTTGGG 0: 1
1: 0
2: 0
3: 15
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146150624 Original CRISPR GCCACTCTTAGGCCCCTTGT TGG (reversed) Exonic
900410464 1:2510317-2510339 GCCACTCTGTGGCCCCTGGGAGG + Intronic
902529538 1:17081741-17081763 GCCATTCTCAGTCCCCTTTTAGG - Intronic
916033991 1:160904812-160904834 GCCAATCTTTTGCACCTTGTAGG + Intergenic
923752326 1:236757270-236757292 GCCACTGTTAGAACCCTGGTGGG + Intronic
1068734275 10:60394376-60394398 GCCATTCATACACCCCTTGTAGG + Intronic
1070150556 10:73802364-73802386 GCCACTCTAATCCCCCTTGTGGG + Exonic
1073190299 10:101646298-101646320 GCCCCTTTAAGGCCCCTGGTTGG - Intronic
1073520840 10:104127588-104127610 GCCACATTTAGGCCCCTGGTTGG - Intergenic
1077135681 11:997087-997109 GCCACCCTGAGGCCCCTTCACGG - Intronic
1077186886 11:1239460-1239482 GCCACTCACAGCCCCCATGTGGG - Exonic
1077444187 11:2582687-2582709 GCCACTCTGGGTCTCCTTGTTGG + Intronic
1083772785 11:64877870-64877892 CCCACTCTTAGACCCCCAGTGGG + Intronic
1091596713 12:1883368-1883390 GCCACTCTTAGGTCTCTTCAGGG + Intronic
1102347795 12:112170541-112170563 GGCACTCTCAGGCCCCCTGGTGG + Intronic
1104639697 12:130459584-130459606 GCCGCCCTTAGCCCCCTTGATGG - Intronic
1115834577 14:37385508-37385530 GCCATTCTTAGGCCACTTTCAGG - Intronic
1118103480 14:62631489-62631511 TCCACTCTCAGACCCCTTATCGG + Intergenic
1119445577 14:74660771-74660793 GCCACTCCCAAACCCCTTGTGGG + Intronic
1125245879 15:37638552-37638574 GACACTCTTGGTCCCCTTGGAGG - Intergenic
1129657240 15:77532318-77532340 GCCTCTCTTAGGACCCTCCTGGG + Intergenic
1131404082 15:92149529-92149551 GCCCCTCTTAGGCCCCACGCTGG + Intronic
1136061640 16:27730694-27730716 GCCTGCCTTAGGCCCCTTGTGGG + Intronic
1136459058 16:30398599-30398621 GCCACACTCAGGGCACTTGTGGG - Exonic
1138189206 16:55000440-55000462 GCCACTCTTAGACCTGTTCTGGG + Intergenic
1138315497 16:56066177-56066199 GCCTCTCTTGAGCCCCTAGTTGG - Intergenic
1139356197 16:66368310-66368332 GCAGCTCTTGGGCCCCTTGGTGG - Intronic
1140191460 16:72820611-72820633 GCCTGTCTTTGGCCTCTTGTTGG + Intronic
1142809072 17:2386871-2386893 GCCACTCAGAGGCCCCCAGTGGG - Exonic
1143315188 17:6026948-6026970 GCCTCTGTGAGGACCCTTGTTGG + Intronic
1144092975 17:11874324-11874346 GCCTCTCTTAGGCCCCTTCAGGG - Intronic
1144736560 17:17558882-17558904 GCTTCTCTTAGGACCCTGGTTGG - Intronic
1146150624 17:30466665-30466687 GCCACTCTTAGGCCCCTTGTTGG - Exonic
1149854850 17:60073099-60073121 GCCTCTATTGGGCCCTTTGTAGG - Intronic
1152919460 17:83058753-83058775 GCCCCTCTCATGCCCCATGTGGG - Intergenic
1157443013 18:47724579-47724601 GACACTCTTGGGCCCCTGGGGGG - Intergenic
1157471757 18:47994244-47994266 GCCACTCCTAGGCCCCAGGAAGG - Intergenic
1159117025 18:64126454-64126476 GGCATTATTAGGCCCCTTCTCGG + Intergenic
1166931308 19:46303344-46303366 GCCCCTCTTAGGGCCCCTGTTGG + Intronic
925298094 2:2791647-2791669 GCCATTCTCAGGCCCCGTGTAGG + Intergenic
926141932 2:10372971-10372993 CCCTCTCTTGGGTCCCTTGTAGG - Intronic
928091054 2:28375379-28375401 GCCACTCCAAGGGCCCTGGTGGG - Intergenic
933929435 2:87133889-87133911 CCTGCTCATAGGCCCCTTGTGGG + Intergenic
934000765 2:87709681-87709703 CCTGCTCATAGGCCCCTTGTGGG + Intergenic
934705250 2:96472865-96472887 TCCTCTCTGAGGCCCCTTGGTGG - Intergenic
936363504 2:111829496-111829518 CCTGCTCATAGGCCCCTTGTGGG - Intronic
937393469 2:121513968-121513990 GCCACTCTTATTCCACTTGTTGG + Intronic
938154399 2:128920216-128920238 GCTACTCTTAGACTCCATGTAGG - Intergenic
938847192 2:135221692-135221714 GCCACCCTCATGCCCCATGTTGG - Intronic
945916305 2:215708062-215708084 GACACTCTTAGGGCCATTGGAGG + Intergenic
946495553 2:220192292-220192314 GCCACTCTCAGTCCCCATTTGGG - Intergenic
948196999 2:236103863-236103885 GCCTCTCCTGGGCCCCTTCTAGG + Intronic
1170067822 20:12333705-12333727 GCCAATCTTAGGCCCTTTGAAGG + Intergenic
1170335906 20:15269899-15269921 GCACCTATTAGGCCCCCTGTAGG + Intronic
1171108626 20:22459842-22459864 GCCAGCCTTAGGCCACTTCTGGG + Intergenic
1173927527 20:46792016-46792038 GCCACACTCAGGTTCCTTGTAGG - Intergenic
1175265365 20:57699869-57699891 GCTTCTCTGAGGTCCCTTGTTGG - Intronic
1178416863 21:32411878-32411900 GCCACTCCTAGGCCACTGGCTGG + Intergenic
1180914222 22:19474114-19474136 GCCACTCTTAGAACCCCTGTGGG + Intronic
1181055739 22:20259791-20259813 GCCACTCCTAGGGACCTTGTGGG + Intronic
1181435543 22:22908320-22908342 GGCACTGTCAGGCCCCTTCTTGG + Intergenic
1181583708 22:23841798-23841820 ACCCCTCTCAGGGCCCTTGTGGG - Intergenic
1184058840 22:42069891-42069913 GCCTCTCTGAGGCCTCTTGAGGG - Intronic
950542895 3:13622669-13622691 TCCTCTCTTAGGCCCCATGTGGG + Intronic
952199476 3:31111386-31111408 ACTTCTCTTAGGCCTCTTGTGGG - Intergenic
955657639 3:61262193-61262215 TCCACTGTTAGTCCCTTTGTAGG + Intergenic
956222807 3:66922543-66922565 GCAACTCTTAGGCAGCTTCTGGG + Intergenic
968299756 3:197603581-197603603 GCCGCTGTCAGGCTCCTTGTGGG + Intergenic
970316425 4:14832428-14832450 GCCACTTCTAGGCTCCATGTTGG + Intergenic
971102508 4:23483480-23483502 GCCACTCGTAGGCCACATGCAGG - Intergenic
975246931 4:72130634-72130656 GCAACTCTCAAGCCCCTTGTGGG + Intronic
986172323 5:5324897-5324919 GCCTCTCTCAAGCCCGTTGTAGG - Intergenic
987737190 5:21861161-21861183 GCCACTGTTAGGACTCCTGTGGG + Intronic
1015557839 6:134481636-134481658 GTGACTCTAGGGCCCCTTGTTGG - Intergenic
1023020199 7:36005064-36005086 GCCACATTTAGCCCCCTTTTGGG + Intergenic
1023341605 7:39227485-39227507 GCAACTCCTAGGCCCCTTCATGG + Intronic
1023763476 7:43488713-43488735 TCCATTCCTGGGCCCCTTGTTGG + Intronic
1029353695 7:100034052-100034074 GCCACACTTAGTGCACTTGTAGG - Exonic
1030244180 7:107362718-107362740 ACCACTCTCATGCCTCTTGTAGG + Intronic
1033282376 7:140015405-140015427 GCCCCTCTTGTGCCCCATGTCGG - Intronic
1034395513 7:150821391-150821413 GCCACTCCTGGGCTCTTTGTAGG - Intergenic
1035386544 7:158476604-158476626 CACACTCTCAGGCCCCTTGGCGG - Intronic
1037579037 8:20233873-20233895 GCCTCTTTTAGGGCCCTAGTGGG - Intergenic
1039241389 8:35560753-35560775 GCCACTCTGATGCCACTGGTTGG + Intronic
1040310151 8:46232656-46232678 GCCACTCTGCGGCCCCGTTTTGG - Intergenic
1046898844 8:119501970-119501992 GCCACTCATGGGCCACTTATGGG - Intergenic
1047832757 8:128654566-128654588 CCCTCTCTTAGGCCCCTTTTGGG - Intergenic
1049427872 8:142545310-142545332 ACAGCTCTTAGGCCCCTTGGTGG + Intergenic
1049615195 8:143572864-143572886 GCCCCTCAAAGGCCCATTGTAGG - Exonic
1062019988 9:134314776-134314798 GCCAGTCTCAGTCCCCTTGGAGG + Intergenic
1203358120 Un_KI270442v1:181499-181521 CACACTCTGAGGCCCGTTGTGGG + Intergenic
1191716493 X:64197235-64197257 GCCACTCTGTGGTCCCTTGCAGG + Intronic
1193363935 X:80608254-80608276 TCCACTCCTACTCCCCTTGTTGG + Intergenic
1195627351 X:107017997-107018019 GCCACTCTCAGGCCCAGTGAGGG - Intergenic
1199160631 X:144607058-144607080 GCCCCTCTTGGGCACCTCGTTGG - Intergenic