ID: 1146157529

View in Genome Browser
Species Human (GRCh38)
Location 17:30536318-30536340
Sequence AAGACTCCCCTTTAAGGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146157529_1146157536 -6 Left 1146157529 17:30536318-30536340 CCCCTGCCTTAAAGGGGAGTCTT 0: 1
1: 0
2: 0
3: 6
4: 118
Right 1146157536 17:30536335-30536357 AGTCTTGCCCTGGAGGACCTGGG 0: 1
1: 0
2: 1
3: 11
4: 181
1146157529_1146157537 -5 Left 1146157529 17:30536318-30536340 CCCCTGCCTTAAAGGGGAGTCTT 0: 1
1: 0
2: 0
3: 6
4: 118
Right 1146157537 17:30536336-30536358 GTCTTGCCCTGGAGGACCTGGGG 0: 1
1: 0
2: 2
3: 22
4: 209
1146157529_1146157535 -7 Left 1146157529 17:30536318-30536340 CCCCTGCCTTAAAGGGGAGTCTT 0: 1
1: 0
2: 0
3: 6
4: 118
Right 1146157535 17:30536334-30536356 GAGTCTTGCCCTGGAGGACCTGG 0: 1
1: 0
2: 1
3: 15
4: 262
1146157529_1146157543 30 Left 1146157529 17:30536318-30536340 CCCCTGCCTTAAAGGGGAGTCTT 0: 1
1: 0
2: 0
3: 6
4: 118
Right 1146157543 17:30536371-30536393 ACCCATCCCACCCCACCCTTTGG 0: 1
1: 2
2: 7
3: 40
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146157529 Original CRISPR AAGACTCCCCTTTAAGGCAG GGG (reversed) Intergenic