ID: 1146159914

View in Genome Browser
Species Human (GRCh38)
Location 17:30554232-30554254
Sequence CACTGTCCCCATGGGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146159904_1146159914 -5 Left 1146159904 17:30554214-30554236 CCCTAGAGCTACAGCCCTCACTG No data
Right 1146159914 17:30554232-30554254 CACTGTCCCCATGGGGAAGGGGG No data
1146159903_1146159914 1 Left 1146159903 17:30554208-30554230 CCACTTCCCTAGAGCTACAGCCC No data
Right 1146159914 17:30554232-30554254 CACTGTCCCCATGGGGAAGGGGG No data
1146159895_1146159914 22 Left 1146159895 17:30554187-30554209 CCCAACTGCCCCTGTTCTCCCCC No data
Right 1146159914 17:30554232-30554254 CACTGTCCCCATGGGGAAGGGGG No data
1146159901_1146159914 3 Left 1146159901 17:30554206-30554228 CCCCACTTCCCTAGAGCTACAGC No data
Right 1146159914 17:30554232-30554254 CACTGTCCCCATGGGGAAGGGGG No data
1146159902_1146159914 2 Left 1146159902 17:30554207-30554229 CCCACTTCCCTAGAGCTACAGCC No data
Right 1146159914 17:30554232-30554254 CACTGTCCCCATGGGGAAGGGGG No data
1146159900_1146159914 4 Left 1146159900 17:30554205-30554227 CCCCCACTTCCCTAGAGCTACAG No data
Right 1146159914 17:30554232-30554254 CACTGTCCCCATGGGGAAGGGGG No data
1146159899_1146159914 12 Left 1146159899 17:30554197-30554219 CCTGTTCTCCCCCACTTCCCTAG No data
Right 1146159914 17:30554232-30554254 CACTGTCCCCATGGGGAAGGGGG No data
1146159905_1146159914 -6 Left 1146159905 17:30554215-30554237 CCTAGAGCTACAGCCCTCACTGT No data
Right 1146159914 17:30554232-30554254 CACTGTCCCCATGGGGAAGGGGG No data
1146159896_1146159914 21 Left 1146159896 17:30554188-30554210 CCAACTGCCCCTGTTCTCCCCCA No data
Right 1146159914 17:30554232-30554254 CACTGTCCCCATGGGGAAGGGGG No data
1146159897_1146159914 14 Left 1146159897 17:30554195-30554217 CCCCTGTTCTCCCCCACTTCCCT No data
Right 1146159914 17:30554232-30554254 CACTGTCCCCATGGGGAAGGGGG No data
1146159898_1146159914 13 Left 1146159898 17:30554196-30554218 CCCTGTTCTCCCCCACTTCCCTA No data
Right 1146159914 17:30554232-30554254 CACTGTCCCCATGGGGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146159914 Original CRISPR CACTGTCCCCATGGGGAAGG GGG Intergenic
No off target data available for this crispr