ID: 1146160687

View in Genome Browser
Species Human (GRCh38)
Location 17:30557872-30557894
Sequence GATGAAGGAGTCGCTCCAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 18, 2: 0, 3: 12, 4: 94}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146160684_1146160687 -8 Left 1146160684 17:30557857-30557879 CCTGGAGACTTGGAGGATGAAGG 0: 18
1: 1
2: 2
3: 36
4: 298
Right 1146160687 17:30557872-30557894 GATGAAGGAGTCGCTCCAGGAGG 0: 1
1: 18
2: 0
3: 12
4: 94
1146160682_1146160687 -4 Left 1146160682 17:30557853-30557875 CCACCCTGGAGACTTGGAGGATG 0: 17
1: 0
2: 4
3: 22
4: 214
Right 1146160687 17:30557872-30557894 GATGAAGGAGTCGCTCCAGGAGG 0: 1
1: 18
2: 0
3: 12
4: 94
1146160683_1146160687 -7 Left 1146160683 17:30557856-30557878 CCCTGGAGACTTGGAGGATGAAG 0: 18
1: 0
2: 5
3: 29
4: 280
Right 1146160687 17:30557872-30557894 GATGAAGGAGTCGCTCCAGGAGG 0: 1
1: 18
2: 0
3: 12
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146160687 Original CRISPR GATGAAGGAGTCGCTCCAGG AGG Exonic
901077597 1:6565017-6565039 GGTGAAGGAGTAGGTACAGGGGG + Intronic
902856492 1:19210092-19210114 GATGAAGGAGTTGCCGCAGCTGG - Exonic
903653346 1:24934060-24934082 GATTAAGGATTCCCTCTAGGAGG + Intronic
903767912 1:25746723-25746745 GCTGAAGGAGGAGTTCCAGGAGG + Exonic
907116984 1:51977550-51977572 GATCAAGGAGAGGCTCCTGGAGG + Intronic
913144573 1:115976633-115976655 GGTGGAGGAGGCGTTCCAGGCGG + Exonic
914719967 1:150281823-150281845 GATGGAGGAGCCGCCCCAGCGGG + Intergenic
917534407 1:175863967-175863989 GATAGAGGAGTCGCTCGAGGAGG + Intergenic
919796037 1:201322178-201322200 GATGAGGCAGTGGCTCCTGGGGG - Intronic
920385714 1:205569128-205569150 GCTGAAGAAGACGCTCCAGTAGG - Exonic
924708238 1:246515100-246515122 GATGAAGGAATCGCTCCAGGAGG - Intergenic
1070596429 10:77835814-77835836 GCTGAAGGAAGCCCTCCAGGAGG - Exonic
1071501486 10:86207284-86207306 GATGAAGCAGTTGTTCCAGAAGG + Intronic
1071876873 10:89851987-89852009 GATCAAGGACTCTCTCCTGGTGG + Intergenic
1072682060 10:97514719-97514741 GATGAAGGAGTTGGTCTGGGAGG + Intronic
1073568954 10:104559841-104559863 GATTCAGGAGTGGCTCCAGGAGG + Intergenic
1076667566 10:132101901-132101923 CATGAAGGGGACTCTCCAGGGGG - Intergenic
1078529662 11:12127238-12127260 GGTGAAAGAATGGCTCCAGGAGG - Intronic
1083679630 11:64345136-64345158 GGAGAAGGAGGCCCTCCAGGCGG + Exonic
1084972195 11:72777997-72778019 GATGACTGGGTCACTCCAGGAGG - Intronic
1089771939 11:120809238-120809260 GATGAAGAAGTCCCTCCATGGGG + Intronic
1093521186 12:20051921-20051943 GATGAAGGAGTCAGTGCAGGAGG + Intergenic
1094169144 12:27473275-27473297 GAAGAAGGATTCTCTCCTGGAGG - Intronic
1095742360 12:45621253-45621275 GAGGAAGGAGATGCTGCAGGGGG + Intergenic
1104803555 12:131570829-131570851 GATGCAGCTGTGGCTCCAGGAGG - Intergenic
1107851312 13:44576175-44576197 GAAGGAGGAATCGCGCCAGGCGG - Exonic
1108835034 13:54533794-54533816 GATGAATGAGTCTCTCCTTGTGG - Intergenic
1110249068 13:73361183-73361205 CATCAAGGAGTCCCTCCATGTGG + Intergenic
1113403626 13:110018437-110018459 GAAGAATGAAGCGCTCCAGGTGG - Intergenic
1113558597 13:111258330-111258352 AAGGAAGGAGTCTCTCCTGGAGG - Intronic
1121380657 14:93463111-93463133 GAAGAAGGATACGTTCCAGGGGG + Intronic
1124432972 15:29622847-29622869 GATGAACGAGTCCTTCCAGATGG + Intergenic
1124961627 15:34401257-34401279 GGGGAAGGAGTCCATCCAGGTGG - Intronic
1124978253 15:34547479-34547501 GGGGAAGGAGTCCATCCAGGTGG - Intronic
1130144551 15:81263924-81263946 GAGGAAGGAGTAACTCCAGCAGG + Intronic
1137567079 16:49539981-49540003 GATGCAGGAGCCGCTCTAAGAGG + Intronic
1143204955 17:5134882-5134904 GATGATGGAGTCGCTCCAGGAGG + Intronic
1144494873 17:15739727-15739749 GATGAAGGAGCCGCTCTGGGAGG + Intronic
1144905382 17:18636945-18636967 GATGAAGGAGCCGCTCTGGGAGG - Intronic
1145760635 17:27423556-27423578 GATGAAGGAGTCGCTCCAGAAGG + Intergenic
1145798401 17:27668739-27668761 GATGAAGGAGTCACTCCAGGAGG - Intergenic
1146160687 17:30557872-30557894 GATGAAGGAGTCGCTCCAGGAGG + Exonic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147170557 17:38616455-38616477 GATGAAGGCCTGGCACCAGGGGG + Intergenic
1147381071 17:40056603-40056625 GATCCAGGAATGGCTCCAGGTGG - Intronic
1149627832 17:58092325-58092347 GATGAAAGAGGCAGTCCAGGTGG + Exonic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1149985776 17:61345762-61345784 AGTGAAGGAGTGGCACCAGGAGG + Intronic
1150069025 17:62137031-62137053 GCTGAAGGAGACACTGCAGGCGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150285498 17:63951621-63951643 GAAGAAGGAGCCGCCCGAGGAGG - Exonic
1150634199 17:66901454-66901476 GATGAAAGAGTGGCTTCTGGAGG - Intergenic
1160543523 18:79638315-79638337 GCAGAAGGAGCCGCTCCCGGGGG + Intergenic
1160725826 19:617431-617453 GCTGAAGGAGACACTGCAGGCGG - Exonic
1162102434 19:8347786-8347808 GTTTAAGGAGTTCCTCCAGGGGG + Intronic
1163219183 19:15902385-15902407 GATGAAGGAGACACTGCAGGTGG - Intergenic
1165695106 19:37894971-37894993 GATGGAGGAGCCGCTGCTGGTGG + Exonic
1165713422 19:38028131-38028153 GATGAATGAATGTCTCCAGGCGG - Intronic
1166521961 19:43486647-43486669 GCTGCAGGAGCCGCTCCATGTGG + Exonic
1166846577 19:45732137-45732159 GAAGAAGAAGAAGCTCCAGGAGG + Intergenic
1168642311 19:58038528-58038550 GTTGCAGGAGGCGCTGCAGGTGG - Intronic
925102973 2:1265245-1265267 GCTGAAGGAGACGATCCAGAGGG + Intronic
925304750 2:2840193-2840215 GGTGAAGCAGAGGCTCCAGGAGG + Intergenic
929592400 2:43155834-43155856 GGTGCAGGACTCACTCCAGGGGG - Intergenic
929600973 2:43204324-43204346 GATGGAGGAGTCACTGCATGGGG - Intergenic
931198063 2:60072024-60072046 GATGAAGTTGTTGCTTCAGGTGG - Intergenic
937041429 2:118823771-118823793 GTTGAAGGAGTCCCTTCTGGTGG + Intergenic
938742831 2:134248864-134248886 AATGAAGCAGTTCCTCCAGGTGG - Intronic
947978560 2:234388210-234388232 GATGAAGGGGTAGCTCCCTGTGG - Intergenic
948684448 2:239661391-239661413 GATGAAGGAGTGGCTCACGCTGG - Intergenic
1171948813 20:31402659-31402681 GATGAAGGAGTTGCTTCTGATGG + Intergenic
1173362959 20:42360830-42360852 AATGAAGGATTTGTTCCAGGCGG - Intronic
1175857551 20:62130539-62130561 GAACAAGGAATCGCTCCAGAGGG + Exonic
1176964820 21:15200408-15200430 GATGAAGGAGTCAGTGCAGAGGG + Intergenic
1178705882 21:34872376-34872398 GCTGGAGGAGTGGCTGCAGGTGG - Intronic
1183639870 22:39086391-39086413 GCTGAAGCAGGGGCTCCAGGAGG - Exonic
1185317055 22:50183800-50183822 GGAGAAGGAGGGGCTCCAGGAGG + Intergenic
953072550 3:39536119-39536141 GATGAAGAAATTGCTCCATGAGG - Intergenic
958846429 3:99270499-99270521 CATGAAGGAGTCACTTCAGTGGG - Intergenic
959991824 3:112639173-112639195 GCTGAAGAAGACGCTGCAGGTGG - Exonic
962258958 3:133891077-133891099 GATGAAGGGCTCCCTGCAGGAGG + Intronic
962313713 3:134344744-134344766 GATGAGGAAGTCCCTCCAGGTGG - Intergenic
962917477 3:139917714-139917736 GATGATGGAGGTGGTCCAGGAGG - Intergenic
964004464 3:151811558-151811580 GGTGAAGGAGTAGGTACAGGGGG - Intergenic
965079773 3:164021159-164021181 GGTGAAGGAGTAGGTACAGGGGG + Intergenic
966055119 3:175677615-175677637 GATGAAGGAGTCCCTGGAGGGGG - Intronic
966882435 3:184357922-184357944 AATGAAGGAGTCCCTCCTGGTGG - Intronic
968965491 4:3767244-3767266 GAAGAAGGAGCCGATGCAGGAGG - Exonic
971555653 4:28011341-28011363 GATGAGGGAGTCGTTCTAGTGGG + Intergenic
979105741 4:116684579-116684601 GATGAAGGTGTAGATGCAGGAGG + Intergenic
997704100 5:135930615-135930637 GCGGGAGGGGTCGCTCCAGGGGG - Intronic
1003256113 6:4476388-4476410 GATGAAGCAGTGGCTGAAGGGGG - Intergenic
1003524587 6:6887036-6887058 GCTGAAGGAGCCCCACCAGGTGG - Intergenic
1010030874 6:71269418-71269440 GATGAAGGAGAAGGTCCTGGTGG + Intergenic
1019593613 7:1848083-1848105 GATGATGGAGGAGCTCCTGGGGG + Exonic
1022616796 7:31940089-31940111 AATGAATCAGTCTCTCCAGGTGG - Intronic
1024886839 7:54152063-54152085 GCTGCAGGAGGCACTCCAGGAGG + Intergenic
1026253952 7:68694631-68694653 GATGATGGATTGGCTGCAGGAGG - Intergenic
1029419181 7:100463590-100463612 GATGGAGAAGACTCTCCAGGTGG - Exonic
1032472011 7:132185387-132185409 GATGAAGGTGTCGGTGCAGGTGG - Exonic
1033610660 7:142961013-142961035 GCTGAAGAAGTCGGTGCAGGGGG + Exonic
1035227145 7:157439888-157439910 GGTGAAGGAGGTGCTCCTGGAGG - Intergenic
1035326948 7:158071534-158071556 GATGATGGAGGTGCTCCTGGTGG + Intronic
1035544985 8:473436-473458 GATGAAGGAGTTGCTCCCCAGGG + Intergenic
1035561185 8:604702-604724 GATGAAAGACAAGCTCCAGGTGG - Intergenic
1039165888 8:34679707-34679729 GATGAAGTGGTGGCTCCAAGGGG - Intergenic
1049241671 8:141540485-141540507 GATCAAGGTGTCCCTCCTGGGGG + Intergenic
1055972616 9:81926873-81926895 GATGAATGTGTAGCTCAAGGAGG - Intergenic
1055974369 9:81941945-81941967 GATGAATGTGTAGCTCAAGGAGG - Intergenic
1062187053 9:135223779-135223801 AATGAAGGAGTCACCCCAGGGGG + Intergenic
1062405475 9:136394262-136394284 GCTGAAGCAATCGCTGCAGGCGG + Exonic
1189446515 X:41085740-41085762 GGTGAAGCCGTCGCTGCAGGAGG + Exonic
1191779075 X:64847455-64847477 GATGAAGGAGTAGGTAGAGGGGG - Intergenic
1201743106 Y:17344286-17344308 GGTGAAGGAGTAGGTACAGGGGG + Intergenic