ID: 1146161310

View in Genome Browser
Species Human (GRCh38)
Location 17:30560624-30560646
Sequence TCGGGCTCACCCCGTGCCTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 2, 1: 0, 2: 16, 3: 10, 4: 86}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146161303_1146161310 5 Left 1146161303 17:30560596-30560618 CCATGCCTACTTTCCCCACAGAT 0: 1
1: 0
2: 2
3: 22
4: 252
Right 1146161310 17:30560624-30560646 TCGGGCTCACCCCGTGCCTGTGG 0: 2
1: 0
2: 16
3: 10
4: 86
1146161297_1146161310 30 Left 1146161297 17:30560571-30560593 CCCAGCCTGGAAGGGCCAGGTCC 0: 5
1: 4
2: 17
3: 33
4: 313
Right 1146161310 17:30560624-30560646 TCGGGCTCACCCCGTGCCTGTGG 0: 2
1: 0
2: 16
3: 10
4: 86
1146161309_1146161310 -10 Left 1146161309 17:30560611-30560633 CCACAGATCTCTCTCGGGCTCAC 0: 21
1: 1
2: 1
3: 12
4: 193
Right 1146161310 17:30560624-30560646 TCGGGCTCACCCCGTGCCTGTGG 0: 2
1: 0
2: 16
3: 10
4: 86
1146161299_1146161310 25 Left 1146161299 17:30560576-30560598 CCTGGAAGGGCCAGGTCCTCCCA 0: 3
1: 4
2: 7
3: 48
4: 287
Right 1146161310 17:30560624-30560646 TCGGGCTCACCCCGTGCCTGTGG 0: 2
1: 0
2: 16
3: 10
4: 86
1146161308_1146161310 -9 Left 1146161308 17:30560610-30560632 CCCACAGATCTCTCTCGGGCTCA 0: 21
1: 1
2: 1
3: 5
4: 100
Right 1146161310 17:30560624-30560646 TCGGGCTCACCCCGTGCCTGTGG 0: 2
1: 0
2: 16
3: 10
4: 86
1146161307_1146161310 -8 Left 1146161307 17:30560609-30560631 CCCCACAGATCTCTCTCGGGCTC 0: 21
1: 1
2: 3
3: 14
4: 184
Right 1146161310 17:30560624-30560646 TCGGGCTCACCCCGTGCCTGTGG 0: 2
1: 0
2: 16
3: 10
4: 86
1146161301_1146161310 9 Left 1146161301 17:30560592-30560614 CCTCCCATGCCTACTTTCCCCAC 0: 1
1: 1
2: 2
3: 34
4: 330
Right 1146161310 17:30560624-30560646 TCGGGCTCACCCCGTGCCTGTGG 0: 2
1: 0
2: 16
3: 10
4: 86
1146161304_1146161310 0 Left 1146161304 17:30560601-30560623 CCTACTTTCCCCACAGATCTCTC 0: 2
1: 0
2: 20
3: 30
4: 320
Right 1146161310 17:30560624-30560646 TCGGGCTCACCCCGTGCCTGTGG 0: 2
1: 0
2: 16
3: 10
4: 86
1146161300_1146161310 15 Left 1146161300 17:30560586-30560608 CCAGGTCCTCCCATGCCTACTTT 0: 1
1: 1
2: 5
3: 14
4: 187
Right 1146161310 17:30560624-30560646 TCGGGCTCACCCCGTGCCTGTGG 0: 2
1: 0
2: 16
3: 10
4: 86
1146161298_1146161310 29 Left 1146161298 17:30560572-30560594 CCAGCCTGGAAGGGCCAGGTCCT 0: 5
1: 5
2: 17
3: 28
4: 320
Right 1146161310 17:30560624-30560646 TCGGGCTCACCCCGTGCCTGTGG 0: 2
1: 0
2: 16
3: 10
4: 86
1146161302_1146161310 6 Left 1146161302 17:30560595-30560617 CCCATGCCTACTTTCCCCACAGA 0: 1
1: 0
2: 4
3: 36
4: 237
Right 1146161310 17:30560624-30560646 TCGGGCTCACCCCGTGCCTGTGG 0: 2
1: 0
2: 16
3: 10
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146161310 Original CRISPR TCGGGCTCACCCCGTGCCTG TGG Exonic
902294858 1:15460160-15460182 CCGGGCTAACCCAGTGCCTTTGG - Intronic
902297601 1:15478973-15478995 CCGGGCTAACCCAGTGCCTTTGG - Intronic
902368456 1:15991685-15991707 TCGGGCTCACCCTGAGCCTTTGG + Intergenic
904379803 1:30103061-30103083 CCGGCCTCACACCCTGCCTGCGG - Intergenic
915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG + Intergenic
915962601 1:160279573-160279595 TCGGGCCCACCAGGTGCCAGTGG - Exonic
919804311 1:201371997-201372019 TCTGGCTCTCCACCTGCCTGAGG + Intronic
920649228 1:207824299-207824321 TCAGGCTCACTCCTTCCCTGAGG + Intergenic
1077575395 11:3379073-3379095 TCTGGATCTCCCGGTGCCTGCGG + Exonic
1078567745 11:12431399-12431421 TCAGGCCCACCACGTGGCTGTGG + Intronic
1084148917 11:67279054-67279076 CCTGGCCCACCCCTTGCCTGGGG + Intronic
1085445749 11:76599513-76599535 TCGTGCTCACCGTGTGGCTGGGG + Intergenic
1085467906 11:76736779-76736801 TCGGTCTCACCGCCAGCCTGTGG - Intergenic
1093352301 12:18118594-18118616 TAGGGTACACCCCGTGCCTGTGG - Intronic
1103556530 12:121770071-121770093 GCGGGCTCACCCAGGGCCTTTGG - Intronic
1103916489 12:124378434-124378456 TCGGGGACTCCCCATGCCTGGGG + Intronic
1104837177 12:131799235-131799257 TCGGCCTCACCCAGAGCCTGTGG - Intronic
1104915785 12:132263774-132263796 ACGGGCCCAGCCGGTGCCTGTGG - Intronic
1104956180 12:132466894-132466916 TCAGGAACACCCTGTGCCTGGGG + Intergenic
1108001335 13:45908105-45908127 TAGGGCTCACCCCCAGCCTCTGG - Intergenic
1112580633 13:100674379-100674401 CCGGGCGCACCCGGCGCCTGCGG - Intronic
1121690711 14:95875978-95876000 GCGGGCTCACCGCGCGCCTCTGG + Intergenic
1122294621 14:100698260-100698282 TCCGGCTCACCCCGCGGCTCTGG + Intergenic
1125607270 15:40947657-40947679 TCCTGCTCTCCCCGAGCCTGTGG + Intergenic
1132734763 16:1379799-1379821 TCGGGCGCACCCGGTCCCCGCGG + Intronic
1138384243 16:56625538-56625560 TCGGGAACACCGCGTACCTGCGG + Exonic
1141479373 16:84296108-84296130 CCTGGCTCACTCCGTCCCTGCGG - Intronic
1142196917 16:88743197-88743219 GCGGGCGCACCCTGTGGCTGGGG + Intronic
1142661947 17:1436747-1436769 TCCGGCCCACCCAGTGGCTGTGG + Exonic
1142966480 17:3585102-3585124 CAGGGCTCACCCCTGGCCTGGGG - Intronic
1143205551 17:5137658-5137680 TCGGGCTCACCCTGCGCCTGTGG + Exonic
1144495582 17:15742916-15742938 TCGGGCTCACCCTGAGACTGTGG + Exonic
1144638621 17:16925916-16925938 TCGGGCTCACCCTGCGACTGTGG - Intergenic
1144876595 17:18400350-18400372 TCGGGCTCACCCTGCGCTTGTGG + Intergenic
1145155631 17:20544070-20544092 TCGGGCTCACCCTGTGCTTGTGG - Intergenic
1145208288 17:20996024-20996046 TCGGGCTCACCCTGCAACTGTGG + Intergenic
1145761264 17:27426467-27426489 TCGGGCTCACCCCGTGCCTGTGG + Intergenic
1145798266 17:27668236-27668258 TTGGGCTCACCCTGCACCTGTGG - Intergenic
1146161310 17:30560624-30560646 TCGGGCTCACCCCGTGCCTGTGG + Exonic
1146843074 17:36168137-36168159 TCGGGCTCACCCTGCGCCTGTGG - Exonic
1146855379 17:36256078-36256100 TCGGGCTCACCCTGCGCCTGTGG - Exonic
1146865242 17:36332297-36332319 TCGGGCTCACCCTGCGCCTGTGG + Exonic
1146871285 17:36379989-36380011 TCGGGCTCACCCTGCGCCTGTGG - Exonic
1146878645 17:36431071-36431093 TCGGGCTCACCCTGCGCCTGTGG - Exonic
1146882593 17:36452217-36452239 TCGGGCTCACCCTGCGCCTGTGG - Intergenic
1147068102 17:37932891-37932913 TCGGGCTCACCCTGCGCCTGTGG + Exonic
1147074171 17:37980613-37980635 TCGGGCTCACCCTGCGCCTGTGG - Intronic
1147079632 17:38012446-38012468 TCGGGCTCACCCTGCGCCTGTGG + Intronic
1147085693 17:38060151-38060173 TCGGGCTCACCCTGCGCCTGTGG - Exonic
1147095573 17:38136388-38136410 TCGGGCTCACCCTGCGCCTGTGG + Intergenic
1147101640 17:38184117-38184139 TCGGGCTCACCCTGCGCCTGTGG - Intergenic
1147371761 17:39997498-39997520 TCTCGCTCACGCCGTTCCTGGGG - Exonic
1147536732 17:41326637-41326659 TCGGGCTCACCCTAAGCCTGTGG + Intergenic
1148238197 17:45983266-45983288 TGGGGCTCCCCTCCTGCCTGAGG + Exonic
1149499125 17:57138223-57138245 GCAGGCTCACACCGTGCCTCAGG + Intergenic
1149846238 17:60010623-60010645 TCGGGCTCACCCTGCGCCTGTGG - Intergenic
1150084587 17:62267202-62267224 TCGGGCTCACCCTGCGCCTCTGG - Intergenic
1154141385 18:11827147-11827169 GCGCGCTCACCACATGCCTGCGG - Intronic
1161001512 19:1913331-1913353 TTGGGGCCACCCCGTGCCAGCGG + Exonic
1162531063 19:11236776-11236798 CCCGGCCCACCCCGTACCTGGGG + Exonic
1165894117 19:39131376-39131398 TCTGGCTCACCACGAGCCAGTGG - Intronic
1168297222 19:55383441-55383463 TGGGGCTCTCCCCGTGCGGGGGG + Intronic
927710554 2:25323093-25323115 ACGTGCTCACCACTTGCCTGGGG - Intronic
929946775 2:46377831-46377853 TCGGGCTCACCCCAAGGCAGAGG - Intronic
934987658 2:98899547-98899569 TAGGGCACTCCCCTTGCCTGTGG - Intronic
937140424 2:119595534-119595556 CCGGGCTCACCTCCTCCCTGTGG + Intronic
938067797 2:128291493-128291515 CTGAGCTCACCCAGTGCCTGGGG - Intronic
943302714 2:186223658-186223680 TAGGTCTCACCCAGGGCCTGTGG - Intergenic
948224597 2:236299126-236299148 TCAGGCTCAGCCCCTCCCTGAGG - Intergenic
1170703456 20:18724963-18724985 TGGGGCTCAGCCCGTGAGTGAGG + Intronic
1171457874 20:25282155-25282177 CCGGGCCCCACCCGTGCCTGTGG + Intronic
1175894485 20:62330029-62330051 TTGGGCACGTCCCGTGCCTGTGG - Intronic
1180219871 21:46351882-46351904 GCGGGCTCACCTGGTGTCTGGGG + Intronic
1181127222 22:20709363-20709385 TGGGGCTAAACCTGTGCCTGGGG + Exonic
1181171620 22:21013138-21013160 TCGGGGACACCCTGTACCTGAGG - Intronic
1181545199 22:23598529-23598551 TCTGTCTCACCCTGTGGCTGGGG + Intergenic
1181815112 22:25431352-25431374 TCTGTCTGACCCCGTGGCTGGGG - Intergenic
1183430478 22:37762739-37762761 TCCGCCTCCTCCCGTGCCTGAGG - Intronic
1184827919 22:46965722-46965744 TCTGCCTCATCCCGTCCCTGTGG + Intronic
952777964 3:37064651-37064673 TAGGGCTCACTCCTAGCCTGTGG + Intronic
953569319 3:44058688-44058710 CTGGGCTCACCTGGTGCCTGAGG + Intergenic
968091327 3:195900110-195900132 TCAGGCTCTCCCTCTGCCTGAGG - Intronic
982175216 4:152699880-152699902 TCGGTCACACCCCATGCCTTGGG + Intronic
982184113 4:152779379-152779401 TCGCGCTGCCCCCGTGCCTGGGG - Intronic
983755472 4:171329285-171329307 TGGGGCTCACCCAGTGCCTGTGG - Intergenic
985682158 5:1261749-1261771 TCCGGCTCACCCTGAGCCTATGG + Intronic
993509871 5:88757888-88757910 GGGGTCTCACCCCGTGCCTCAGG - Intronic
1000318915 5:160118743-160118765 CCGGGCTCACTCCCTCCCTGGGG + Intronic
1001424800 5:171616131-171616153 CCAGGCTCAGCCCCTGCCTGGGG - Intergenic
1006731608 6:36240232-36240254 TCTGGCTCCACTCGTGCCTGTGG + Intergenic
1020118198 7:5488037-5488059 CCGGGCTCAGCTTGTGCCTGAGG + Intronic
1022508585 7:30921709-30921731 TGGGGCTCGCCCCTTGCCTCTGG + Intronic
1026222045 7:68407201-68407223 TCGGTCATTCCCCGTGCCTGAGG + Intergenic
1029548445 7:101223585-101223607 CCAGGCTCACCCCTTCCCTGTGG - Intronic
1035355386 7:158273470-158273492 TGCGGCTCCCCCTGTGCCTGCGG - Intronic
1035355392 7:158273488-158273510 TGCGGCTCCCCCTGTGCCTGCGG - Intronic
1035355411 7:158273562-158273584 TGCGGCTCCCCCTGTGCCTGCGG - Intronic
1035355518 7:158274056-158274078 TGCGGCTCCCCCTGTGCCTGCGG - Intronic
1035355591 7:158274384-158274406 TGTGGCTCCCCCTGTGCCTGCGG - Intronic
1035355597 7:158274402-158274424 TGCGGCTCCCCCTGTGCCTGTGG - Intronic
1035355615 7:158274488-158274510 TGTGGCTCCCCCTGTGCCTGCGG - Intronic
1035355627 7:158274523-158274545 TGTGGCTCCCCCTGTGCCTGCGG - Intronic
1035755347 8:2026960-2026982 TCTGGCTGACTCGGTGCCTGAGG + Intergenic
1039442510 8:37605014-37605036 TCAAGCTCACCCCGGGTCTGGGG - Intergenic
1045971471 8:108083429-108083451 GCGGGCGCACCCCTTGCCTGGGG - Exonic
1049178823 8:141209965-141209987 TGGGGGCCACCCCTTGCCTGAGG - Intronic
1049545564 8:143229107-143229129 TCGGGCAGACCCCATGCCGGAGG - Intergenic
1054324840 9:63707830-63707852 TCGAGCCCACGCCGTGCCTCAGG + Intergenic
1057183039 9:93040077-93040099 TTGGGCCCAGCCGGTGCCTGGGG + Intergenic
1059755728 9:117291527-117291549 TACGGCTCACCCAGTGCCTCGGG - Intronic
1061515599 9:131088118-131088140 ACCTGCTCACCCGGTGCCTGTGG - Intronic
1189426883 X:40909803-40909825 ACGGGAACACCCAGTGCCTGGGG + Intergenic
1199189047 X:144949503-144949525 TGGGGCTCACCCAGGCCCTGTGG - Intergenic
1200062703 X:153490652-153490674 TGGGCCTCACTCCGAGCCTGTGG - Intronic