ID: 1146172050

View in Genome Browser
Species Human (GRCh38)
Location 17:30641935-30641957
Sequence GGGGCTGCTGGGAGCCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146172050_1146172054 -4 Left 1146172050 17:30641935-30641957 CCTCTCTGGCTCCCAGCAGCCCC No data
Right 1146172054 17:30641954-30641976 CCCCATCCTTCCCCCAGTCTTGG No data
1146172050_1146172057 1 Left 1146172050 17:30641935-30641957 CCTCTCTGGCTCCCAGCAGCCCC No data
Right 1146172057 17:30641959-30641981 TCCTTCCCCCAGTCTTGGCCCGG No data
1146172050_1146172059 2 Left 1146172050 17:30641935-30641957 CCTCTCTGGCTCCCAGCAGCCCC No data
Right 1146172059 17:30641960-30641982 CCTTCCCCCAGTCTTGGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146172050 Original CRISPR GGGGCTGCTGGGAGCCAGAG AGG (reversed) Intergenic
No off target data available for this crispr