ID: 1146175476

View in Genome Browser
Species Human (GRCh38)
Location 17:30663650-30663672
Sequence CTGTGGATAAGGATGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146175476_1146175489 14 Left 1146175476 17:30663650-30663672 CCTCCCTCCATCCTTATCCACAG No data
Right 1146175489 17:30663687-30663709 AGACCCTCCTCTCCAAACCGGGG No data
1146175476_1146175487 12 Left 1146175476 17:30663650-30663672 CCTCCCTCCATCCTTATCCACAG No data
Right 1146175487 17:30663685-30663707 CCAGACCCTCCTCTCCAAACCGG No data
1146175476_1146175488 13 Left 1146175476 17:30663650-30663672 CCTCCCTCCATCCTTATCCACAG No data
Right 1146175488 17:30663686-30663708 CAGACCCTCCTCTCCAAACCGGG No data
1146175476_1146175490 15 Left 1146175476 17:30663650-30663672 CCTCCCTCCATCCTTATCCACAG No data
Right 1146175490 17:30663688-30663710 GACCCTCCTCTCCAAACCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146175476 Original CRISPR CTGTGGATAAGGATGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr