ID: 1146175574

View in Genome Browser
Species Human (GRCh38)
Location 17:30664042-30664064
Sequence GTGCCCTCCCCCATTTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146175574_1146175582 10 Left 1146175574 17:30664042-30664064 CCTTGGGAAATGGGGGAGGGCAC No data
Right 1146175582 17:30664075-30664097 GGGACCTCCCTCCTGAATCTGGG No data
1146175574_1146175581 9 Left 1146175574 17:30664042-30664064 CCTTGGGAAATGGGGGAGGGCAC No data
Right 1146175581 17:30664074-30664096 TGGGACCTCCCTCCTGAATCTGG No data
1146175574_1146175577 -10 Left 1146175574 17:30664042-30664064 CCTTGGGAAATGGGGGAGGGCAC No data
Right 1146175577 17:30664055-30664077 GGGAGGGCACTGGTACCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146175574 Original CRISPR GTGCCCTCCCCCATTTCCCA AGG (reversed) Intergenic
No off target data available for this crispr