ID: 1146176627

View in Genome Browser
Species Human (GRCh38)
Location 17:30669339-30669361
Sequence CCCTCTAGGAAGAGGGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146176615_1146176627 30 Left 1146176615 17:30669286-30669308 CCTCGGGGCTGCTGGGGCCTCAG No data
Right 1146176627 17:30669339-30669361 CCCTCTAGGAAGAGGGGGCCTGG No data
1146176618_1146176627 -9 Left 1146176618 17:30669325-30669347 CCTCTTGCCGCCTTCCCTCTAGG No data
Right 1146176627 17:30669339-30669361 CCCTCTAGGAAGAGGGGGCCTGG No data
1146176617_1146176627 13 Left 1146176617 17:30669303-30669325 CCTCAGAGGCGCTAATGAAGCGC No data
Right 1146176627 17:30669339-30669361 CCCTCTAGGAAGAGGGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146176627 Original CRISPR CCCTCTAGGAAGAGGGGGCC TGG Intergenic
No off target data available for this crispr