ID: 1146180320

View in Genome Browser
Species Human (GRCh38)
Location 17:30693939-30693961
Sequence CCACCGCCAGGGTGTCAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146180314_1146180320 -10 Left 1146180314 17:30693926-30693948 CCACTTCATCACGCCACCGCCAG No data
Right 1146180320 17:30693939-30693961 CCACCGCCAGGGTGTCAGGCGGG No data
1146180311_1146180320 4 Left 1146180311 17:30693912-30693934 CCACCCGGCAAGCACCACTTCAT No data
Right 1146180320 17:30693939-30693961 CCACCGCCAGGGTGTCAGGCGGG No data
1146180310_1146180320 5 Left 1146180310 17:30693911-30693933 CCCACCCGGCAAGCACCACTTCA No data
Right 1146180320 17:30693939-30693961 CCACCGCCAGGGTGTCAGGCGGG No data
1146180308_1146180320 11 Left 1146180308 17:30693905-30693927 CCTCCGCCCACCCGGCAAGCACC No data
Right 1146180320 17:30693939-30693961 CCACCGCCAGGGTGTCAGGCGGG No data
1146180313_1146180320 0 Left 1146180313 17:30693916-30693938 CCGGCAAGCACCACTTCATCACG No data
Right 1146180320 17:30693939-30693961 CCACCGCCAGGGTGTCAGGCGGG No data
1146180312_1146180320 1 Left 1146180312 17:30693915-30693937 CCCGGCAAGCACCACTTCATCAC No data
Right 1146180320 17:30693939-30693961 CCACCGCCAGGGTGTCAGGCGGG No data
1146180309_1146180320 8 Left 1146180309 17:30693908-30693930 CCGCCCACCCGGCAAGCACCACT No data
Right 1146180320 17:30693939-30693961 CCACCGCCAGGGTGTCAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146180320 Original CRISPR CCACCGCCAGGGTGTCAGGC GGG Intergenic