ID: 1146180580

View in Genome Browser
Species Human (GRCh38)
Location 17:30695728-30695750
Sequence ACTTCCTGGAAAATAGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146180580_1146180586 8 Left 1146180580 17:30695728-30695750 CCCTGGGCTATTTTCCAGGAAGT No data
Right 1146180586 17:30695759-30695781 TCAAAACATCACTAAGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146180580 Original CRISPR ACTTCCTGGAAAATAGCCCA GGG (reversed) Intergenic
No off target data available for this crispr