ID: 1146180631

View in Genome Browser
Species Human (GRCh38)
Location 17:30696077-30696099
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146180631_1146180643 27 Left 1146180631 17:30696077-30696099 CCACGCCTGGACCAGTGGCTCCC No data
Right 1146180643 17:30696127-30696149 CAGACATTTGTCACAACTGGGGG No data
1146180631_1146180640 24 Left 1146180631 17:30696077-30696099 CCACGCCTGGACCAGTGGCTCCC No data
Right 1146180640 17:30696124-30696146 CAACAGACATTTGTCACAACTGG No data
1146180631_1146180641 25 Left 1146180631 17:30696077-30696099 CCACGCCTGGACCAGTGGCTCCC No data
Right 1146180641 17:30696125-30696147 AACAGACATTTGTCACAACTGGG No data
1146180631_1146180642 26 Left 1146180631 17:30696077-30696099 CCACGCCTGGACCAGTGGCTCCC No data
Right 1146180642 17:30696126-30696148 ACAGACATTTGTCACAACTGGGG No data
1146180631_1146180644 28 Left 1146180631 17:30696077-30696099 CCACGCCTGGACCAGTGGCTCCC No data
Right 1146180644 17:30696128-30696150 AGACATTTGTCACAACTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146180631 Original CRISPR GGGAGCCACTGGTCCAGGCG TGG (reversed) Intergenic