ID: 1146180632

View in Genome Browser
Species Human (GRCh38)
Location 17:30696082-30696104
Sequence CAGATGGGAGCCACTGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146180632_1146180644 23 Left 1146180632 17:30696082-30696104 CCTGGACCAGTGGCTCCCATCTG No data
Right 1146180644 17:30696128-30696150 AGACATTTGTCACAACTGGGGGG No data
1146180632_1146180643 22 Left 1146180632 17:30696082-30696104 CCTGGACCAGTGGCTCCCATCTG No data
Right 1146180643 17:30696127-30696149 CAGACATTTGTCACAACTGGGGG No data
1146180632_1146180642 21 Left 1146180632 17:30696082-30696104 CCTGGACCAGTGGCTCCCATCTG No data
Right 1146180642 17:30696126-30696148 ACAGACATTTGTCACAACTGGGG No data
1146180632_1146180640 19 Left 1146180632 17:30696082-30696104 CCTGGACCAGTGGCTCCCATCTG No data
Right 1146180640 17:30696124-30696146 CAACAGACATTTGTCACAACTGG No data
1146180632_1146180641 20 Left 1146180632 17:30696082-30696104 CCTGGACCAGTGGCTCCCATCTG No data
Right 1146180641 17:30696125-30696147 AACAGACATTTGTCACAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146180632 Original CRISPR CAGATGGGAGCCACTGGTCC AGG (reversed) Intergenic