ID: 1146180634

View in Genome Browser
Species Human (GRCh38)
Location 17:30696088-30696110
Sequence CACCATCAGATGGGAGCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146180634_1146180640 13 Left 1146180634 17:30696088-30696110 CCAGTGGCTCCCATCTGATGGTG No data
Right 1146180640 17:30696124-30696146 CAACAGACATTTGTCACAACTGG No data
1146180634_1146180641 14 Left 1146180634 17:30696088-30696110 CCAGTGGCTCCCATCTGATGGTG No data
Right 1146180641 17:30696125-30696147 AACAGACATTTGTCACAACTGGG No data
1146180634_1146180643 16 Left 1146180634 17:30696088-30696110 CCAGTGGCTCCCATCTGATGGTG No data
Right 1146180643 17:30696127-30696149 CAGACATTTGTCACAACTGGGGG No data
1146180634_1146180644 17 Left 1146180634 17:30696088-30696110 CCAGTGGCTCCCATCTGATGGTG No data
Right 1146180644 17:30696128-30696150 AGACATTTGTCACAACTGGGGGG No data
1146180634_1146180645 26 Left 1146180634 17:30696088-30696110 CCAGTGGCTCCCATCTGATGGTG No data
Right 1146180645 17:30696137-30696159 TCACAACTGGGGGGTGCTGCTGG No data
1146180634_1146180642 15 Left 1146180634 17:30696088-30696110 CCAGTGGCTCCCATCTGATGGTG No data
Right 1146180642 17:30696126-30696148 ACAGACATTTGTCACAACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146180634 Original CRISPR CACCATCAGATGGGAGCCAC TGG (reversed) Intergenic