ID: 1146180636

View in Genome Browser
Species Human (GRCh38)
Location 17:30696098-30696120
Sequence GGGGCATAATCACCATCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146180636_1146180640 3 Left 1146180636 17:30696098-30696120 CCATCTGATGGTGATTATGCCCC No data
Right 1146180640 17:30696124-30696146 CAACAGACATTTGTCACAACTGG No data
1146180636_1146180643 6 Left 1146180636 17:30696098-30696120 CCATCTGATGGTGATTATGCCCC No data
Right 1146180643 17:30696127-30696149 CAGACATTTGTCACAACTGGGGG No data
1146180636_1146180641 4 Left 1146180636 17:30696098-30696120 CCATCTGATGGTGATTATGCCCC No data
Right 1146180641 17:30696125-30696147 AACAGACATTTGTCACAACTGGG No data
1146180636_1146180642 5 Left 1146180636 17:30696098-30696120 CCATCTGATGGTGATTATGCCCC No data
Right 1146180642 17:30696126-30696148 ACAGACATTTGTCACAACTGGGG No data
1146180636_1146180645 16 Left 1146180636 17:30696098-30696120 CCATCTGATGGTGATTATGCCCC No data
Right 1146180645 17:30696137-30696159 TCACAACTGGGGGGTGCTGCTGG No data
1146180636_1146180644 7 Left 1146180636 17:30696098-30696120 CCATCTGATGGTGATTATGCCCC No data
Right 1146180644 17:30696128-30696150 AGACATTTGTCACAACTGGGGGG No data
1146180636_1146180646 26 Left 1146180636 17:30696098-30696120 CCATCTGATGGTGATTATGCCCC No data
Right 1146180646 17:30696147-30696169 GGGGTGCTGCTGGTATGTAATGG No data
1146180636_1146180647 30 Left 1146180636 17:30696098-30696120 CCATCTGATGGTGATTATGCCCC No data
Right 1146180647 17:30696151-30696173 TGCTGCTGGTATGTAATGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146180636 Original CRISPR GGGGCATAATCACCATCAGA TGG (reversed) Intergenic