ID: 1146180640

View in Genome Browser
Species Human (GRCh38)
Location 17:30696124-30696146
Sequence CAACAGACATTTGTCACAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146180635_1146180640 4 Left 1146180635 17:30696097-30696119 CCCATCTGATGGTGATTATGCCC No data
Right 1146180640 17:30696124-30696146 CAACAGACATTTGTCACAACTGG No data
1146180634_1146180640 13 Left 1146180634 17:30696088-30696110 CCAGTGGCTCCCATCTGATGGTG No data
Right 1146180640 17:30696124-30696146 CAACAGACATTTGTCACAACTGG No data
1146180631_1146180640 24 Left 1146180631 17:30696077-30696099 CCACGCCTGGACCAGTGGCTCCC No data
Right 1146180640 17:30696124-30696146 CAACAGACATTTGTCACAACTGG No data
1146180632_1146180640 19 Left 1146180632 17:30696082-30696104 CCTGGACCAGTGGCTCCCATCTG No data
Right 1146180640 17:30696124-30696146 CAACAGACATTTGTCACAACTGG No data
1146180636_1146180640 3 Left 1146180636 17:30696098-30696120 CCATCTGATGGTGATTATGCCCC No data
Right 1146180640 17:30696124-30696146 CAACAGACATTTGTCACAACTGG No data
1146180630_1146180640 27 Left 1146180630 17:30696074-30696096 CCACCACGCCTGGACCAGTGGCT No data
Right 1146180640 17:30696124-30696146 CAACAGACATTTGTCACAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146180640 Original CRISPR CAACAGACATTTGTCACAAC TGG Intergenic