ID: 1146180645

View in Genome Browser
Species Human (GRCh38)
Location 17:30696137-30696159
Sequence TCACAACTGGGGGGTGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146180634_1146180645 26 Left 1146180634 17:30696088-30696110 CCAGTGGCTCCCATCTGATGGTG No data
Right 1146180645 17:30696137-30696159 TCACAACTGGGGGGTGCTGCTGG No data
1146180638_1146180645 -4 Left 1146180638 17:30696118-30696140 CCCTAACAACAGACATTTGTCAC No data
Right 1146180645 17:30696137-30696159 TCACAACTGGGGGGTGCTGCTGG No data
1146180637_1146180645 -3 Left 1146180637 17:30696117-30696139 CCCCTAACAACAGACATTTGTCA No data
Right 1146180645 17:30696137-30696159 TCACAACTGGGGGGTGCTGCTGG No data
1146180639_1146180645 -5 Left 1146180639 17:30696119-30696141 CCTAACAACAGACATTTGTCACA No data
Right 1146180645 17:30696137-30696159 TCACAACTGGGGGGTGCTGCTGG No data
1146180635_1146180645 17 Left 1146180635 17:30696097-30696119 CCCATCTGATGGTGATTATGCCC No data
Right 1146180645 17:30696137-30696159 TCACAACTGGGGGGTGCTGCTGG No data
1146180636_1146180645 16 Left 1146180636 17:30696098-30696120 CCATCTGATGGTGATTATGCCCC No data
Right 1146180645 17:30696137-30696159 TCACAACTGGGGGGTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146180645 Original CRISPR TCACAACTGGGGGGTGCTGC TGG Intergenic