ID: 1146182453

View in Genome Browser
Species Human (GRCh38)
Location 17:30706909-30706931
Sequence CAGGCTGGACACCTGGATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146182453_1146182464 24 Left 1146182453 17:30706909-30706931 CCCAGATCCAGGTGTCCAGCCTG No data
Right 1146182464 17:30706956-30706978 GCTCTGCAGCCATGAAATCCTGG No data
1146182453_1146182465 25 Left 1146182453 17:30706909-30706931 CCCAGATCCAGGTGTCCAGCCTG No data
Right 1146182465 17:30706957-30706979 CTCTGCAGCCATGAAATCCTGGG No data
1146182453_1146182458 -6 Left 1146182453 17:30706909-30706931 CCCAGATCCAGGTGTCCAGCCTG No data
Right 1146182458 17:30706926-30706948 AGCCTGGCCACCCAGATTCAAGG No data
1146182453_1146182460 -2 Left 1146182453 17:30706909-30706931 CCCAGATCCAGGTGTCCAGCCTG No data
Right 1146182460 17:30706930-30706952 TGGCCACCCAGATTCAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146182453 Original CRISPR CAGGCTGGACACCTGGATCT GGG (reversed) Intergenic
No off target data available for this crispr