ID: 1146182525

View in Genome Browser
Species Human (GRCh38)
Location 17:30707322-30707344
Sequence AGGGAAAAGGGTTCCTGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146182525_1146182531 5 Left 1146182525 17:30707322-30707344 CCTACTCAGGAACCCTTTTCCCT No data
Right 1146182531 17:30707350-30707372 CATTCATTCTGCAAAGCGCCTGG No data
1146182525_1146182533 29 Left 1146182525 17:30707322-30707344 CCTACTCAGGAACCCTTTTCCCT No data
Right 1146182533 17:30707374-30707396 TAGCAATGCACTCTCTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146182525 Original CRISPR AGGGAAAAGGGTTCCTGAGT AGG (reversed) Intergenic
No off target data available for this crispr