ID: 1146183143

View in Genome Browser
Species Human (GRCh38)
Location 17:30709708-30709730
Sequence CTTCCCCCCAGCCCCGGCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146183135_1146183143 -4 Left 1146183135 17:30709689-30709711 CCCCGCCACCTCCTACCAGCTTC 0: 1
1: 0
2: 5
3: 26
4: 374
Right 1146183143 17:30709708-30709730 CTTCCCCCCAGCCCCGGCTCCGG No data
1146183132_1146183143 5 Left 1146183132 17:30709680-30709702 CCGCCCTCGCCCCGCCACCTCCT 0: 1
1: 2
2: 14
3: 170
4: 1562
Right 1146183143 17:30709708-30709730 CTTCCCCCCAGCCCCGGCTCCGG No data
1146183136_1146183143 -5 Left 1146183136 17:30709690-30709712 CCCGCCACCTCCTACCAGCTTCC 0: 1
1: 3
2: 6
3: 160
4: 1393
Right 1146183143 17:30709708-30709730 CTTCCCCCCAGCCCCGGCTCCGG No data
1146183137_1146183143 -6 Left 1146183137 17:30709691-30709713 CCGCCACCTCCTACCAGCTTCCC 0: 1
1: 2
2: 7
3: 122
4: 1115
Right 1146183143 17:30709708-30709730 CTTCCCCCCAGCCCCGGCTCCGG No data
1146183134_1146183143 1 Left 1146183134 17:30709684-30709706 CCTCGCCCCGCCACCTCCTACCA 0: 1
1: 0
2: 8
3: 63
4: 756
Right 1146183143 17:30709708-30709730 CTTCCCCCCAGCCCCGGCTCCGG No data
1146183138_1146183143 -9 Left 1146183138 17:30709694-30709716 CCACCTCCTACCAGCTTCCCCCC 0: 1
1: 1
2: 8
3: 102
4: 1023
Right 1146183143 17:30709708-30709730 CTTCCCCCCAGCCCCGGCTCCGG No data
1146183130_1146183143 30 Left 1146183130 17:30709655-30709677 CCAGGGGAAGGAAGGGACACGGA No data
Right 1146183143 17:30709708-30709730 CTTCCCCCCAGCCCCGGCTCCGG No data
1146183133_1146183143 2 Left 1146183133 17:30709683-30709705 CCCTCGCCCCGCCACCTCCTACC 0: 1
1: 1
2: 5
3: 43
4: 555
Right 1146183143 17:30709708-30709730 CTTCCCCCCAGCCCCGGCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146183143 Original CRISPR CTTCCCCCCAGCCCCGGCTC CGG Intergenic
No off target data available for this crispr