ID: 1146184683

View in Genome Browser
Species Human (GRCh38)
Location 17:30717197-30717219
Sequence GCCTCCCTTCCTGCCAACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146184683_1146184693 16 Left 1146184683 17:30717197-30717219 CCATAGTTGGCAGGAAGGGAGGC No data
Right 1146184693 17:30717236-30717258 AGGCCAGGAGGCAACCAGCAAGG No data
1146184683_1146184690 1 Left 1146184683 17:30717197-30717219 CCATAGTTGGCAGGAAGGGAGGC No data
Right 1146184690 17:30717221-30717243 AGGAGGCCAGAAGGGAGGCCAGG No data
1146184683_1146184686 -8 Left 1146184683 17:30717197-30717219 CCATAGTTGGCAGGAAGGGAGGC No data
Right 1146184686 17:30717212-30717234 AGGGAGGCCAGGAGGCCAGAAGG No data
1146184683_1146184696 22 Left 1146184683 17:30717197-30717219 CCATAGTTGGCAGGAAGGGAGGC No data
Right 1146184696 17:30717242-30717264 GGAGGCAACCAGCAAGGTGAGGG No data
1146184683_1146184691 4 Left 1146184683 17:30717197-30717219 CCATAGTTGGCAGGAAGGGAGGC No data
Right 1146184691 17:30717224-30717246 AGGCCAGAAGGGAGGCCAGGAGG 0: 2
1: 1
2: 10
3: 101
4: 754
1146184683_1146184688 -4 Left 1146184683 17:30717197-30717219 CCATAGTTGGCAGGAAGGGAGGC No data
Right 1146184688 17:30717216-30717238 AGGCCAGGAGGCCAGAAGGGAGG No data
1146184683_1146184695 21 Left 1146184683 17:30717197-30717219 CCATAGTTGGCAGGAAGGGAGGC No data
Right 1146184695 17:30717241-30717263 AGGAGGCAACCAGCAAGGTGAGG No data
1146184683_1146184687 -7 Left 1146184683 17:30717197-30717219 CCATAGTTGGCAGGAAGGGAGGC No data
Right 1146184687 17:30717213-30717235 GGGAGGCCAGGAGGCCAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146184683 Original CRISPR GCCTCCCTTCCTGCCAACTA TGG (reversed) Intergenic