ID: 1146184689

View in Genome Browser
Species Human (GRCh38)
Location 17:30717219-30717241
Sequence TGGCCTCCCTTCTGGCCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146184689_1146184700 24 Left 1146184689 17:30717219-30717241 CCAGGAGGCCAGAAGGGAGGCCA No data
Right 1146184700 17:30717266-30717288 CAGAAGCAGCCAGCACTTGGTGG No data
1146184689_1146184693 -6 Left 1146184689 17:30717219-30717241 CCAGGAGGCCAGAAGGGAGGCCA No data
Right 1146184693 17:30717236-30717258 AGGCCAGGAGGCAACCAGCAAGG No data
1146184689_1146184695 -1 Left 1146184689 17:30717219-30717241 CCAGGAGGCCAGAAGGGAGGCCA No data
Right 1146184695 17:30717241-30717263 AGGAGGCAACCAGCAAGGTGAGG No data
1146184689_1146184698 21 Left 1146184689 17:30717219-30717241 CCAGGAGGCCAGAAGGGAGGCCA No data
Right 1146184698 17:30717263-30717285 GGCCAGAAGCAGCCAGCACTTGG No data
1146184689_1146184696 0 Left 1146184689 17:30717219-30717241 CCAGGAGGCCAGAAGGGAGGCCA No data
Right 1146184696 17:30717242-30717264 GGAGGCAACCAGCAAGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146184689 Original CRISPR TGGCCTCCCTTCTGGCCTCC TGG (reversed) Intergenic