ID: 1146184692

View in Genome Browser
Species Human (GRCh38)
Location 17:30717227-30717249
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146184692_1146184696 -8 Left 1146184692 17:30717227-30717249 CCAGAAGGGAGGCCAGGAGGCAA No data
Right 1146184696 17:30717242-30717264 GGAGGCAACCAGCAAGGTGAGGG No data
1146184692_1146184702 26 Left 1146184692 17:30717227-30717249 CCAGAAGGGAGGCCAGGAGGCAA No data
Right 1146184702 17:30717276-30717298 CAGCACTTGGTGGAAGCTTCAGG 0: 1
1: 0
2: 2
3: 20
4: 216
1146184692_1146184695 -9 Left 1146184692 17:30717227-30717249 CCAGAAGGGAGGCCAGGAGGCAA No data
Right 1146184695 17:30717241-30717263 AGGAGGCAACCAGCAAGGTGAGG No data
1146184692_1146184698 13 Left 1146184692 17:30717227-30717249 CCAGAAGGGAGGCCAGGAGGCAA No data
Right 1146184698 17:30717263-30717285 GGCCAGAAGCAGCCAGCACTTGG No data
1146184692_1146184700 16 Left 1146184692 17:30717227-30717249 CCAGAAGGGAGGCCAGGAGGCAA No data
Right 1146184700 17:30717266-30717288 CAGAAGCAGCCAGCACTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146184692 Original CRISPR TTGCCTCCTGGCCTCCCTTC TGG (reversed) Intergenic